 |
 |

Embryonic Myosin Heavy-Chain Mutations Cause Distal Arthrogryposis and Developmental Myosin Myopathy That Persists Postnatally
Homa Tajsharghi, PhD;
Eva Kimber, MD;
Anna-Karin Kroksmark, PhD;
Ragnar Jerre, MD;
Mar Tulinius, MD, PhD;
Anders Oldfors, MD, PhD
Arch Neurol. 2008;65(8):1083-1090.
ABSTRACT
Background Myosin is a molecular motor and the essential part of the thick filament of striated muscle. The expression of myosin heavy-chain (MyHC) isoforms is developmentally regulated. The embryonic isoform encoded from MYH3 (OMIM *160720) is expressed during fetal life. Recently, mutations in MYH3 were demonstrated to be associated with congenital joint contractures, that is, Freeman-Sheldon and Sheldon-Hall syndromes, which are both distal arthrogryposis syndromes. Mutations in other MyHC isoforms cause myopathy. It is unknown whether MYH3 mutations cause myopathy because muscle tissue has not been studied.
Objectives To determine whether novel MYH3 mutations are associated with distal arthrogryposis and to demonstrate myopathic changes in muscle biopsy specimens from 4 patients with distal arthrogryposis and MYH3 mutations.
Design In a cohort of patients with distal arthrogryposis, we analyzed the entire coding sequence of MYH3. Muscle biopsy specimens were obtained, and in addition to morphologic analysis, the expression of MyHC isoforms was investigated at the protein and transcript levels.
Results We identified patients from 3 families with novel MYH3 mutations. These mutations affect developmentally conserved residues that are located in different regions of the adenosine triphosphate–binding pocket of the MyHC head. The embryonic (MYH3) isoform was not detected in any of the muscle biopsy samples, indicating a normal developmental downregulation of MYH3 in these patients. However, morphologic analysis of muscle biopsy specimens from the 4 patients revealed mild and variable myopathic features and a pathologic upregulation of the fetal MyHC isoform (MYH8) in 1 patient.
Conclusions Distal arthrogryposis associated with MYH3 mutations is secondary to myosin myopathy, and postnatal muscle manifestations are variable.
INTRODUCTION
Myosin is the main component of skeletal muscle sarcomeric thick filaments (Figure 1). It consists of 2 globular heads attached to a long -helical–coiled coil rod domain. It is a hexamer composed of 1 pair of myosin heavy chains (MyHCs) and 2 pairs of myosin light chains. The myosin globular head domain of the myosin motor (myosin subfragment 1 [S1]) contains actin and adenosine triphosphate (ATP)–binding regions and is responsible for the force transduction properties of myosin.1 Several striated muscle MyHC genes have been described.2 The expression of myosin isoforms is developmentally regulated.3-5
|
|
|
|
Figure 1. Schematic illustration of the sarcomere. A, Electron micrograph of the skeletal muscle sarcomere. B, Schematic illustration of the sarcomere. Z- and M-bands are indicated. The thin filaments contain actin, tropomyosin, and troponin complex composed of troponins C, I, and T. The thick filaments are composed of myosin, with the globular heads forming cross-bridges with thin filaments and the light meromyosin, which constitutes the thick filament backbone and lies along the thick filament axis.
|
|
|
Myosin myopathies have evolved as a new group of muscle diseases caused by mutations in skeletal muscle myosin heavy-chain (MyHC) genes6 (Table 1). The phenotypes of these diseases vary, ranging from prenatal nonprogressive arthrogryposis syndromes to adult-onset progressive muscle weakness. Mutations have been reported in 2 of 3 MyHC isoforms expressed in adult limb skeletal muscle. In addition to familial hypertrophic or dilated cardiomyopathy,11 mutations in the slow or β-cardiac MyHC gene (MYH7) cause skeletal myopathies such as myosin storage myopathy14-18 and Laing early-onset distal myopathy.12-13 A mutation in the MyHC IIa gene (MYH2) is associated with dominant myopathy characterized by ophthalmoplegia, congenital joint contractures, and rimmed vacuoles in muscle fibers.7-9 Recently, Freeman-Sheldon syndrome and Sheldon-Hall syndrome, both distal arthrogryposis syndromes (DA2A and DA2B, respectively), have been reported as the first disorders associated with mutations in embryonic MyHC (MYH3).10 Distal arthrogryposis syndromes are characterized by congenital contractures of at least 2 different body areas, with frequent involvement of the hands and feet, but there may also be proximal joint involvement.20-21
|
|
|
|
Table 1. Diseases Associated With Mutations in Skeletal Muscle Myosin Heavy Chains
|
|
|
Distal arthrogryposis syndromes are associated with missense mutations in various genes coding for sarcomeric proteins. The genes thus far demonstrated to be involved in distal arthrogryposis syndromes are TNNI2 (troponin I) (OMIM *191043),22-23 TPM2 (β-tropomyosin) (OMIM *190990),23-24 TNNT3 (troponin T) (OMIM *606092),25 MYH8 (perinatal MyHC) (OMIM *160741),19 and MYH3 (embryonic MyHC).10 These findings indicate that distal arthrogryposis syndromes are caused by myopathies with onset during fetal development, but few studies have involved analysis of muscle tissue in these diseases.22, 24, 26 In this article, we report novel MYH3 mutations associated with distal arthrogryposis and demonstrate myopathic changes in muscle biopsy specimens from 4 patients with distal arthrogryposis and MYH3 mutations.
METHODS
PATIENTS
Patients 1 and 2 were mother and daughter with DA2B. The clinical features included short stature, scoliosis, mild facial dysmorphism, decreased muscle strength, and contractures in proximal and distal joints including the shoulder joints (Figure 2). Patient 3 was a man with a milder form of DA2B. The clinical features included contractures, primarily in the hands, with mild involvement of the jaws, feet, and elbows, and normal muscle strength (Figure 3). No involvement of the shoulder joints was noted. He had 3 children who all had signs of distal arthrogryposis. Patient 4 had sporadic DA2A with ptosis, very short stature, small and contracted mouth, and joint contractures in the proximal and distal joints. Joint involvement included the ankles and feet. Muscle strength was difficult to evaluate owing to young age, which was 4 years at the last assessment.
|
|
|
|
Figure 2. Patients 1 (A) and 2 (B) showing palmar malposition of the thumbs and mild ulnar deviation and extension defects in the proximal interphalangeal joints in patient 1.
|
|
|
|
|
|
|
Figure 3. Patient 3 showing short flexor tendons and extension defects in the metacarpophalangeal joints.
|
|
|
GENETIC ANALYSES
Extraction of genomic DNA, sequence analysis, and the polymerase chain reaction were performed as previously described.22 The entire coding sequence of MYH3 was sequenced using previously described primers.10 The presence of each mutation was confirmed in each affected individual at restriction fragment length polymorphism analysis (Table 2). The restriction fragment length polymorphism was also used to screen for the presence of each mutation in 200 control chromosomes. In addition to MYH3, the entire coding region of the TPM2, TNNI2, TNNT3, TNNI1 (OMIM *191042), TNNT1 (OMIM *191041), TNNC1 (OMIM *191040), and TNNC2 (OMIM *191039) genes was sequenced in patients 1 and 3.
|
|
|
|
Table 2. Polymerase Chain Reaction Primers and Restriction Enzymes Used for Mutation Analysis
|
|
|
MORPHOLOGIC ANALYSIS OF MUSCLE TISSUE
Morphologic enzyme-histochemical and immunohistochemical analyses were performed as previously described.9 To identify embryonic (MYH3) MyHC expression, a monoclonal antibody, F1.652 (Developmental Studies Hydridoma Bank, Department of Biologic Sciences, University of Iowa, Iowa City), at a concentration of 1:100 was used.
ANALYSIS OF MYHC TRANSCRIPTS IN MUSCLE TISSUE
Total RNA was extracted from muscle tissue from the patients and control subjects as previously described.9 In addition to analysis of the percentage of the 3 major MyHC isoforms, MyHC I, MyHC IIa, and MyHC IIx, by using previously described primers,9 the polymerase chain reaction was performed on complementary DNA with a fluorescein-labeled (6-carboxyfluorescein [FAM]) forward primer, TCCCTAAGGCAACAGACACCT, corresponding to nucleotide 1628-1648 of human MyHC IIa complementary DNA (GenBank AF111784) combined with a previously described backward primer to amplify MyHC IIa, MyHC IIx, and embryonic MyHC. Amplification of MyHC IIa, MyHC IIx, and embryonic MYHC results in 505–, 499–, and 496–base pair fragments, respectively. MyHC I was amplified using an MyHC I–specific fluorescein-labeled (hexachlorocarboxyfluorescein [HEX]) forward primer, TCCCCAAGGCCACCGACATGA, corresponding to nucleotide 1697-1717 of human MyHC I complementary DNA (GenBank XM-033374) combined with the same backward primer. Amplification of MyHC I also results in a 496–base pair fragment.
ANALYSIS OF MYHC COMPOSITION IN MUSCLE TISSUE
Proteins extracted from two 10-µm-thick sections of muscle biopsy specimens were separated using 8% sodium dodecylsulfate–polyacrylamide gel electrophoresis.9
RESULTS
GENETIC ANALYSES
The entire coding sequence of MYH3 was investigated in the index subjects of the respective families. Three different missense mutations were identified (Figure 4A). In patients 1 and 2 with DA2B, a heterozygous missense mutation in exon 13, A1454G, changing the negatively charged aspartate at position 462 to the nonpolar glycine, was identified. The D462G mutation was not identified in any of the 4 investigated relatives without distal arthrogryposis. In patient 3 with DA2B, a heterozygous missense mutation in exon 7, C769T, changing the nonpolar alanine at position 234 to the polar threonine, was identified. The mutation was also identified in all 3 affected children of patient 3. In patient 4 with sporadic DA2A, a heterozygous missense mutation in exon 5, C602T, changing the highly conserved threonine at position 178 to the methionine, was identified. The T178M was an apparent de novo mutation because neither of the parents carried the mutation.
|
|
|
|
Figure 4. Genetic analyses of the embryonic MyHC gene (MYH3) in patients with distal arthrogryposis syndromes and the positions of the mutations. A, Sequence chromatograms of part of exon 13, exon 7, and exon 5 of MYH3 in patients 1 through 4, respectively. The T178M mutation is shown in the sense orientation, and the A234T and D462G mutations are shown in the reverse orientation on the genomic DNA. B, Illustration of quantitative analysis of relative expression of myosin heavy-chain (MyHC) I, MyHC IIa, MyHC IIx, and embryonic MyHC messenger RNA based on reverse transcriptase–polymerase chain reaction (PCR). The PCR was performed on complementary DNA with a fluorescein-labeled (6-carboxyfluorescein [6-FAM]) forward primer combined with backward primer to amplify MyHC IIa, MyHC IIx, and embryonic MyHC. Amplification of MyHC IIa, MyHC IIx, and embryonic MyHC results in 505–, 499–, and 496–base pair fragments, respectively. The MyHC I was amplified by using an MyHC I-specific fluorescein-labeled (hexachlorocarboxyfluorescein [HEX]) forward primer combined with the same backward primer. The fluorescent PCR products were separated in polyacrylamide gels, and the intensity of the respective peaks was analyzed. A muscle biopsy specimen with ongoing regeneration was used as control to detect the expression of embryonic MyHC.
|
|
|
The mutations were confirmed at restriction fragment length polymorphism analysis and were not identified in 200 control chromosomes (Table 2). One common polymorphism at position 1192 changing alanine to threonine was also identified in patients as well as control subjects.
EXPRESSION OF MYHC ISOFORMS
The relative expression of the 3 major MyHC isoforms in skeletal muscle and the presence of embryonic MyHC were determined at the messenger RNA level using reverse transcription–polymerase chain reaction analysis (Figure 4B). None of the muscle biopsy specimens from the patients demonstrated expression of embryonic MyHC. However, analysis of a muscle biopsy specimen with ongoing regeneration, which was used as a positive control to detect embryonic MyHC, demonstrated expression of this isoform.
The relative amount of the expression of MyHC isoforms at the protein level was determined using sodium dodecylsulfate–polyacrylamide gel electrophoresis. It roughly corresponded to the relative amounts of messenger RNA (H.T., unpublished data, September 4, 2006).
MORPHOLOGIC ANALYSIS
Muscle biopsy specimens from the deltoid muscle in patients 1 and 2 exhibited slight pathologic changes. There was increased variability of fiber size owing to the presence of frequent small type-1 fibers (Figure 5). There was also a slightly abnormal type-1 fiber predominance. A muscle biopsy specimen from the deltoid muscle of patient 3 showed scattered, small, type-1 fibers but no obvious pathologic changes (Figure 5). Muscle biopsy specimens from the tibialis anterior muscle of patient 4 at ages 15 months and 5 years showed slight pathologic changes (Figure 6). The major abnormality at age 15 months was numerous fibers (>20% of all fibers) expressing the fetal (perinatal) isoform of MyHC (MYH8). Specimens from 8 controls aged 10 to 15 months showed only occasional muscle fibers (0%-2% of all fibers) expressing fetal MyHC. The biopsy specimen obtained at age 5 years showed marked type-1 fiber predominance and scattered, small, type-1 fibers. No fibers expressed fetal MyHC at age 5 years in patient 4. Expression of embryonic MyHC (MYH3) was not identified in any patients.
|
|
|
|
Figure 5. Muscle biopsy specimens from the deltoid muscle of patients 1 (A and B), 2 (C and D), and 3 (E and F) show increased variability of fiber size owing to scattered, small, type-1 fibers. This change is most obvious in patients 1 and 2. A, C, and E, Hematoxylin-eosin; B, D, and F, adenosine triphosphatase, pH 4.3. Bars indicate 65 µm.
|
|
|
|
|
|
|
Figure 6. Muscle biopsy specimens from the tibialis anterior muscle of patient 4 at age 15 months (A, C, and D) and at 5 years (E and F). A, At age 15 months, frequent fibers expressed the fetal (perinatal) isoform of myosin heavy-chain (MyHC). At age 15 months (C and D) and 5 years (E and F), there were minor pathologic changes with slightly increased interstitial connective tissue and frequent small type-1 fibers. B, A specimen from a representative healthy control subject aged 11 months shows only a few scattered muscle fibers expressing fetal MyHC. C and E, Hematoxylin-eosin; D and F, adenosine triphosphatase, pH 4.3. Bars indicate 50 µm.
|
|
|
COMMENT
In this study, we identified 3 MYH3 mutations in 4 patients with DA2A and DA2B and also obtained morphologic evidence of myopathy in these patients. The 3 identified MYH3 mutations are located in different regions of the ATP-binding pocket of the MyHC of the myosin motor S1 domain (Figure 7). Their locations indicate that they may disrupt ATP binding or ATP hydrolysis. The mutated residue, T178M, in patient 4 is situated adjacent to the base of the ATP-binding pocket in the amino terminal 25-kDa domain known as the phosphate-binding loop.27 The phosphate-binding loop is composed of the invariant GESGAGKT (179-186 of embryonic myosin heavy-chain) sequence that is universally conserved in all myosins sequenced to date.27 Furthermore, mutations in the T178 residue have previously been reported in 3 patients with DA2A and 2 patients with DA2B.10 The mutated residue in patient 3, A234, is highly conserved in other human MyHC isoforms and during evolution. It is located close to the helix (Leu217-Gly232) that forms part of the nucleotide-binding pocket in the 50-kDa segment of the S1 domain.27-28 The D462G mutation in patients 1 and 2 is located in the highly conserved region, next to Ile463 and Gly465, which are of major importance for the conformational changes during ATP binding and hydrolysis.27-28 Because the ATP-binding pocket governs the release of actin from the myosin on nucleotide binding, the mutations may affect myosin-actin intraction.27 These mutations add to the previously reported mutations, which are distributed through the MYH3 gene10 (Figure 8).
|
|
|
|
Figure 7. Ribbon model of myosin heavy-chain (MyHC) subfragment 1 (S1) of chicken skeletal muscle. The adenosine triphosphate (ATP)– and actin-binding sites are indicated. The highly conserved ATP-binding site (Gly179-Thr186) is shown in red, and yellow spheres indicate the position of T178 in human embryonic MyHC, which was mutated (T178M) in patient 4. The position of A234, which was mutated (A234T) in patient 3, is indicated by light blue spheres. Orange spheres indicate the position of D462, which was mutated (D462G) in patients 1 and 2. The ribbon diagram was drawn using commercially available software (WebLab ViewerLite 3.2; Molecular Simulations, Inc, San Diego, California).
|
|
|
|
|
|
|
Figure 8. Genomic structure of MYH3 with location of the distal arthrogryposis–causing mutations and the embryonic MyHC protein. The 3 mutations reported herein are indicated in red. *The nucleotide substitution, C602T, which leads to the amino acid substitution threonine to methionine at position 178 (T178M), was erroneously described as giving rise to a threonine 178 isoleucine substitution (T178I) in a previous report.10 The major proteolytic subfragments S1, S2, and light meromyosin (LMM) of the MyHC protein are indicated.
|
|
|
Embryonic MyHC is normally not expressed in postnatal human limb muscles unless there is ongoing muscle regeneration. Because there was a mutation in MYH3 and some patients experienced muscle weakness, we investigated the expression of this gene at both the protein and the transcript levels. We found no embryonic MyHC in any of the examined samples. However, the muscle tissue was not free of pathologic changes. The abnormally high expression of fetal MyHC at age 15 months in patient 4 may possibly reflect a developmental defect because fetal MyHC is expressed during muscle development and then usually is downregulated perinatally.
Other pathologic alterations were type-1 fiber predominance and frequent small type-1 fibers. In patient 4, there was also a slight increase in interstitial connective tissue. It may, therefore, be speculated that in patients with distal arthrogryposis caused by MYH3 mutations, there is a severe myopathy during fetal development that causes joint contractures, and when the embryonic MyHC is downregulated, there is a restitution of muscle development, leaving some residual defects in muscle. This may be compared with myopathy with congenital joint contractures caused by mutations in MyHC IIa (MYH2), in which there is an increased expression of the mutated MyHC IIa with age, which is accompanied by muscle degeneration and progressive muscle weakness and wasting.8-9 However, the long-term course of joint contractures and muscle weakness in patients with distal arthrogryposis associated with MYH3 mutations remains to be investigated.
To our knowledge, few studies have addressed the question of muscle pathology in distal arthrogryposis associated with mutations in sarcomeric proteins. However, available studies demonstrate that patients with distal arthrogryposis caused by mutations in the β-tropomyosin and troponin I genes may have myopathy.22, 24
In conclusion, the results of this study add MYH3 to the list of MyHC genes that are involved in hereditary myosin myopathies.6 Additional studies are necessary to establish how MYH3 mutations affect structural and functional dysfunction during fetal development.
AUTHOR INFORMATION
Correspondence: Homa Tajsharghi, PhD, Department of Pathology, Sahlgrenska University Hospital, Gula Stråket 8, SE-413 45 Göteborg, Sweden (homa.tajsharghi{at}gu.se).
Accepted for Publication: February 25, 2008.
Author Contributions: Dr Tajsharghi had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. Study concept and design: Tajsharghi, Kimber, Kroksmark, Tulinius, and Oldfors. Acquisition of data: Tajsharghi, Kimber, Kroksmark, Jerre, Tulinius, and Oldfors. Analysis and interpretation of data: Tajsharghi, Kimber, Kroksmark, Tulinius, and Oldfors. Drafting of the manuscript: Tajsharghi. Critical revision of the manuscript for important intellectual content: Tajsharghi, Kimber, Kroksmark, Jerre, Tulinius, and Oldfors. Statistical analysis: Tajsharghi. Obtained funding: Kimber and Oldfors. Administrative, technical, and material support: Tajsharghi, Kroksmark, Jerre, and Tulinius. Study supervision: Tajsharghi.
Financial Disclosure: None reported.
Funding/Support: This study was supported by a grant from the Swedish Research Council (Project No. 7122) (Dr Oldfors), Association Francaise Contre le Myopathies (Dr Oldfors), and Linnéa och Josef Carlssons Stiftelse (Dr Kimber).
Additional Contributions: Gabriella Almén, BSc, and Lili Seifi, BSc, provided technical assistance. We thank the patients for their participation in this study.
Author Affiliations: Departments of Pathology (Drs Tajsharghi and Oldfors) and Orthopedics (Dr Jerre), Sahlgrenska University Hospital; Departments of Pediatrics, Institute for Clinical Sciences, Sahlgrenska Academy at Göteborg University (Drs Kimber, Kroksmark, and Tulinius) and Queen Silvia's Children's Hospital (Drs Kroksmark and Tulinius), Göteborg; and Department of Neuropediatrics, Uppsala University Childre s Hospital, Uppsala (Dr Kimber); Sweden.
REFERENCES
1. Weiss A, Schiaffino S, Leinwand LA. Comparative sequence analysis of the complete human sarcomeric myosin heavy chain family: implications for functional diversity. J Mol Biol. 1999;290(1):61-75.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
2. Weiss A, Leinwand LA. The mammalian myosin heavy chain gene family. Annu Rev Cell Dev Biol. 1996;12:417-439.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
3. Butler-Browne GS, Barbet JP, Thornell LE. Myosin heavy and light chain expression during human skeletal muscle development and precocious muscle maturation induced by thyroid hormone. Anat Embryol (Berl). 1990;181(6):513-522.
PUBMED
4. Hughes SM, Cho M, Karsch-Mizrachi I; et al. Three slow myosin heavy chains sequentially expressed in developing mammalian skeletal muscle. Dev Biol. 1993;158(1):183-199.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
5. Cho M, Hughes SM, Karsch-Mizrachi I, Travis M, Leinwand LA, Blau HM. Fast myosin heavy chains expressed in secondary mammalian muscle fibers at the time of their inception. J Cell Sci. 1994;107(pt 9):2361-2371.
FREE FULL TEXT
6. Oldfors A. Hereditary myosin myopathies. Neuromuscul Disord. 2007;17(5):355-367.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
7. Darin N, Kyllerman M, Wahlström J, Martinsson T, Oldfors A. Autosomal dominant myopathy with congenital joint contractures, ophthalmoplegia, and rimmed vacuoles. Ann Neurol. 1998;44(2):242-248.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
8. Martinsson T, Oldfors A, Darin N; et al. Autosomal dominant myopathy: missense mutation (Glu-706–> Lys) in the myosin heavy chain IIa gene. Proc Natl Acad Sci U S A. 2000;97(26):14614-14619.
FREE FULL TEXT
9. Tajsharghi H, Thornell LE, Darin N; et al. Myosin heavy chain IIa gene mutation E706K is pathogenic and its expression increases with age. Neurology. 2002;58(5):780-786.
FREE FULL TEXT
10. Toydemir RM, Rutherford A, Whitby FG, Jorde LB, Carey JC, Bamshad MJ. Mutations in embryonic myosin heavy chain (MYH3) cause Freeman-Sheldon syndrome and Sheldon-Hall syndrome. Nat Genet. 2006;38(5):561-565.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
11. Seidman JG, Seidman C. The genetic basis for cardiomyopathy: from mutation identification to mechanistic paradigms. Cell. 2001;104(4):557-567.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
12. Meredith C, Herrmann R, Parry C; et al. Mutations in the slow skeletal muscle fiber myosin heavy chain gene (MYH7) cause Laing early-onset distal myopathy (MPD1). Am J Hum Genet. 2004;75(4):703-708.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
13. Darin N, Tajsharghi H, Ostman-Smith I, Gilljam T, Oldfors A. New skeletal myopathy and cardiomyopathy associated with a missense mutation in MYH7. Neurology. 2007;68(23):2041-2042.
FREE FULL TEXT
14. Tajsharghi H, Thornell LE, Lindberg C, Lindvall B, Henriksson KG, Oldfors A. Myosin storage myopathy associated with a heterozygous missense mutation in MYH7. Ann Neurol. 2003;54(4):494-500.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
15. Tajsharghi H, Oldfors A, Macleod DP, Swash M. Homozygous mutation in MYH7 in myosin storage myopathy and cardiomyopathy [case report]. Neurology. 2007;68(12):962.
FREE FULL TEXT
16. Laing NG, Ceuterick-de Groote C, Dye DE; et al. Myosin storage myopathy: slow skeletal myosin (MYH7) mutation in two isolated cases. Neurology. 2005;64(3):527-529.
FREE FULL TEXT
17. Tajsharghi H, Oldfors A, Swash M. Myosin storage myopathy with cardiomyopathy [letter]. Neuromuscul Disord. 2007;17(9-10):725.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
18. Bohlega S, Abu-Amero SN, Wakil SM; et al. Mutation of the slow myosin heavy chain rod domain underlies hyaline body myopathy. Neurology. 2004;62(9):1518-1521.
FREE FULL TEXT
19. Veugelers M, Bressan M, McDermott DA; et al. Mutation of perinatal myosin heavy chain associated with a Carney complex variant. N Engl J Med. 2004;351(5):460-469.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
20. Hall JG, Reed SD, Greene G. The distal arthrogryposes: delineation of new entities; review and nosologic discussion. Am J Med Genet. 1982;11(2):185-239.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
21. Bamshad M, Jorde LB, Carey JC. A revised and extended classification of the distal arthrogryposes. Am J Med Genet. 1996;65(4):277-281.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
22. Kimber E, Tajsharghi H, Kroksmark AK, Oldfors A, Tulinius M. A mutation in the fast skeletal muscle troponin I gene causes myopathy and distal arthrogryposis. Neurology. 2006;67(4):597-601.
FREE FULL TEXT
23. Sung SS, Brassington AM, Grannatt K; et al. Mutations in genes encoding fast-twitch contractile proteins cause distal arthrogryposis syndromes. Am J Hum Genet. 2003;72(3):681-690.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
24. Tajsharghi H, Kimber E, Holmgren D, Tulinius M, Oldfors A. Distal arthrogryposis and muscle weakness associated with a beta-tropomyosin mutation. Neurology. 2007;68(10):772-775.
FREE FULL TEXT
25. Sung SS, Brassington AM, Krakowiak PA, Carey JC, Jorde LB, Bamshad M. Mutations in TNNT3 cause multiple congenital contractures: a second locus for distal arthrogryposis type 2B. Am J Hum Genet. 2003;73(1):212-214.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
26. Ochala J, Li M, Tajsharghi H; et al. Effects of a R133W beta-tropomyosin mutation on regulation of muscle contraction in single human muscle fibres. J Physiol. 2007;581(pt 3):1283-1292.
FREE FULL TEXT
27. Ruppel KM, Spudich JA. Structure-function analysis of the motor domain of myosin. Annu Rev Cell Dev Biol. 1996;12:543-573.
FULL TEXT
|
WEB OF SCIENCE
| PUBMED
28. Rayment I, Rypniewski WR, Schmidt-Bäse K; et al. Three-dimensional structure of myosin subfragment-1: a molecular motor. Science. 1993;261(5117):50-58.
FREE FULL TEXT
CiteULike Connotea Delicious Digg Facebook Reddit Technorati Twitter
What's this?
RELATED ARTICLE
This Month in Archives of Neurology
Arch Neurol. 2008;65(8):1013-1014.
FULL TEXT
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES
Fetal akinesia: review of the genetics of the neuromuscular causes
Ravenscroft et al.
J. Med. Genet. 2011;48:793-801.
ABSTRACT
| FULL TEXT
Knockdown of embryonic myosin heavy chain reveals an essential role in the morphology and function of the developing heart
Rutland et al.
Development 2011;138:3955-3966.
ABSTRACT
| FULL TEXT
|