 |
 |

Muscle Phenotype and Mutation Load in 51 Persons With the 3243A>G Mitochondrial DNA Mutation
Tina D. Jeppesen, MD;
Marianne Schwartz, PhD;
Anja L. Frederiksen, MD;
Flemming Wibrand, PhD;
David B. Olsen, MD;
John Vissing, MD, PhD
Arch Neurol. 2006;63:1701-1706.
ABSTRACT
 |  |
Background Mitochondrial disorders are generally not associated with a clear phenotype-genotype relationship, which complicates the understanding of the disease and genetic counseling.
Objective To investigate the relationship between the muscle and blood mitochondrial DNA mutation load and phenotype.
Design Survey.
Setting The Neuromuscular Research Unit, Rigshospitalet, Copenhagen, Denmark.
Participants Fifty-one persons with the 3243A>G point mutation of mitochondrial DNA, and 20 healthy control subjects.
Methods We recorded the maximal oxygen uptake ( O2max), maximal workload, resting and peak-exercise plasma lactate levels, muscle and blood mutation load, muscle morphology, and presence of diabetes mellitus and hearing impairment in all subjects.
Results Muscle mutation load (mean ± SE, 50% ± 5%; range, 2%-95%) correlated with O2max and resting plasma lactate level (P<.001; R 0.64). All persons except 5 with a muscle mutation load above 50% had abnormal O2max and morphology on muscle biopsy findings. Persons with hearing impairment and diabetes mellitus had a muscle mutation load above 65%. The mutation load in blood (mean ± SE, 18% ± 3%; range, 0%-61%) did not correlate with O2max, resting plasma lactate levels, or presence of hearing impairment or diabetes mellitus.
Conclusions This study demonstrates a close relationship between the muscle mutation load and phenotype in persons carrying the 3243A>G mutation. The lack of correlation between the mutation load in blood and symptoms from other tissues emphasizes the importance of assessing phenotype-genotype correlations in the same tissue in mitochondrial disease. The results indicate that the threshold of muscle mutation load at which oxidative impairment occurs can be as low as 50%, which is as much as 40% lower than that suggested by in vitro studies.
INTRODUCTION
Since the discovery of the first mitochondrial DNA (mtDNA) mutations in 1988,1-2 more than 200 disease-causing mutations in the mtDNA have been discovered. The spectrum of phenotypes associated with these mutations is extensive, although these mutations generally lead to the same cellular dysfunction, ie, impaired oxidative phosphorylation. Pathogenic mtDNA mutations usually coexist with wild-type (normal) mtDNA in cells, even within the same mitochondrion: a condition called heteroplasmy. The wide spectrum of phenotypes associated with mitochondrial disease can partly be explained by the high variability of the mtDNA mutation load in different tissues. It is generally believed that symptoms emerge in a tissue when the level of wild-type mtDNA can no longer support a sufficient production of respiratory chain enzymes and, thus, adenosine triphosphate production. Based on findings in vitro, the threshold level for mutation load at which symptoms emerge has been set at 90% in tissues carrying the 3243A>G point mutations of mtDNA.3
The high variation in mutation load among the tissues in mitochondrial diseases suggests that the assessment of phenotype and genotype must be performed in the same tissue. It is therefore not surprising that previous attempts in persons with point mutations of mtDNA to correlate the mutation load in one tissue with the phenotype of another tissue have generally failed.4-20
Skeletal muscle is known to carry a relatively high mutation load in mitochondrial diseases caused by mtDNA mutations. During exercise, skeletal muscle can increase its oxygen demand up to 100-fold, which is unmatched by any other tissue. Mitochondrial myopathy with exercise intolerance, premature exertional dyspnea, and lactic acid buildup is therefore one of the most frequent symptoms in patients with mtDNA mutations. In this study, we tested 51 persons, all harboring the common 3243A>G point mutation of mtDNA, to investigate the mutation typespecific correlation between the skeletal muscle mutation load and indices of oxidative capacity, ie, maximal oxygen uptake ( O2max), maximal workload (Wmax), plasma lactate levels, muscle morphology, and mitochondrial enzyme activity levels. Muscle mutation load was also correlated with symptoms of hearing impairment and diabetes mellitus that arise in 2 other postmitotic tissues. To investigate the importance of assessing the phenotype and mutation load in the same tissue, we also studied the relationship between the blood mutation load and the symptoms from skeletal muscle and 2 other postmitotic tissues in the 51 subjects.
METHODS
SUBJECTS
We included in the study 51 persons (22 men and 29 women) from 13 families with the 3243A>G point mutation of mtDNA. The mean ± SD demographic data of the patients were age of 40 ± 15 (range, 13-74) years, weight of 66 ± 15 (range, 43-96) kg, and height of 169 ± 8 (range, 158-186) cm. To study a wide range of mutation load in muscle, we also investigated relatives from 9 of the 13 families. Genetic investigation of muscle from 42 family members revealed that 38 relatives carried at least 2% of the 3243A>G mtDNA mutation in muscle. These 38 relatives were included in the study, along with the 13 probands. The findings in the persons with the 3243A>G mutation were compared with findings in 20 healthy sedentary control subjects (10 men and 10 women) with a mean ± SD age of 39 ± 13 years, weight of 74 ± 14 kg, and height of 174 ± 8 cm. Fourteen of the 51 persons with the 3243A>G mutation in muscle had diabetes mellitus and were treated with insulin or diet. An oral glucose tolerance test was performed in 29 of the remaining 37 persons. A neurological examination was performed in the 51 persons carrying the 3243A>G mutation, and they were interviewed about clinical symptoms related to hearing impairment, strokelike episodes, ataxia, and the presence of exercise intolerance. The presence of exercise intolerance was based on self-reported symptoms of impaired work capacity (dyspnea during mild exercise, premature fatigue, or muscle pain or cramps) or on clear evidence in the medical history of problems in running, cycling, walking stairs, or participating in school gym lessons. Apart from the insulin and antiepileptic treatments in 4 persons, no subject took any medication.
The study was approved by the scientific ethical committee of Copenhagen, Denmark. The subjects were all informed about the nature and risks of the study and gave written consent to participate.
PREEXPERIMENTAL PREPARATIONS
All subjects reported to the laboratory at 9 AM after an overnight fast and ingestion of a breakfast that contained approximately 100 g of carbohydrates 2 hours before the experiment. The subjects did not consume any alcohol or caffeine for 12 hours and did not perform any exercise for 24 hours before the experiment. Resting lactate levels were evaluated after 45 minutes of rest in the supine position.
EXPERIMENTAL PROTOCOL
All subjects underwent studies on a cycle ergometer (MedGraphics CPE 2000; Medical Graphics Corp, St Paul, Minn) operated via a cardiopulmonary exercise test system (MedGraphics CPX/D; Medical Graphics Corp) that measured gas exchanges, workload, and heart rate. We determined O2max and Wmax in all subjects by means of an incremental exercise test to exhaustion. We applied 2- to 5-W increments every other minute in the maximum test for patients with mitochondrial disease and a medical history of severe exercise intolerance, 5- to 15-W increments every other minute for patients with a medical history of moderate exercise intolerance, and 15- to 25-W increments every other minute in unaffected relatives and healthy controls. These increments in workload were applied to reach a similar duration of the cycle test in all subjects. Blood samples were collected from the median cubital vein at rest and at exhaustion.
MUSCLE BIOPSY
A needle biopsy of the left lateral vastus muscle was performed in the 13 probands, the 38 relatives, and in all healthy controls. The biopsy specimen was frozen immediately after sampling in isopentane, cooled in liquid nitrogen, and stored at 80°C until genetic, biochemical, and morphological analyses.
The muscle biopsy specimen was stained with trichrome, succinate dehydrogenase, and cytochrome oxidase (COX), and we assessed the number of ragged red/blue fibers and COX-negative fibers.
MOLECULAR GENETIC INVESTIGATIONS
Total genomic DNA from muscle and blood was isolated using a DNA kit (QIAamp DNA Mini Kit; QIAGEN GmbH, Hilden, Germany) and following the manufacturer's protocol. An allele-specific polymerase chain reaction (PCR) assay was designed, allowing the detection of the 3243A>G mutation by a direct PCR reaction. Two sets of primers were used in 1 reaction tube: 3014L (forward) GTGCAGCCGCTATTAAAGGT and 3262HM17 (reverse with 2 mismatches) TTTTATGCGATTACCGCGCC (PCR product, 249 base pairs). The control product was coamplified using the following primers: 5289-5309 (forward) and 5903-5884 (reverse) (PCR product, 614 base pairs).
QUANTIFICATION OF MUTANT mtDNA
The ratio between the wild-type mtDNA (3243A) and mutant mtDNA (3243G) was determined using solid-phase minisequencing.21-22 The PCR products spanning the position in question were generated by the 5'-biotinylated primer (3014-3033) and the primer (3376-3357). The PCR products were immobilized on a streptavidin-coated solid support (96-well plate) and denatured by sodium hydroxide. To quantify the ratios of 3243A and 3243G in the sample, the sequencing primer (3263-3244) was designed to anneal adjacent (downstream) to nucleotide 3243. The nucleotide at the site of the mutation was analyzed by primer extension reaction, in which a tritium-labeled deoxyribonucleotide triphosphate corresponding to the 3243A (deoxythymidine triphosphate) or the 3243G (deoxycytidine triphosphate) nucleotide was added to 2 parallel reactions. After washing, the elongated primers were eluted by sodium hydroxide, and the amount of incorporated tritium-labeled deoxyribonucleoside monophosphate was determined using a liquid scintillation counter. The ratio of T to C incorporated into each sequencing primer was determined and compared with a standard curve constructed using known proportions of cloned mitochondrial 3243A and 3243G.22
BIOCHEMICAL ANALYSES
Venous blood was sampled in syringes containing 50 µL of 0.33M EDTA solution, immediately spun at 4°C, and studied for lactate levels on a commercially available analyzer (YSI model 2300 STAT Plus; Bie & Berntsen, Rødovre, Denmark).
Mitochondrial enzyme activities of citrate synthase and complexes I to IV were measured in postnuclear supernatants of 30 µg of frozen muscle in 36 of the 51 persons carrying the 3243A>G mutation as previously described.23
STATISTICAL ANALYSES
Differences between persons carrying the 3243A>G mtDNA mutation and healthy controls were evaluated by a t test. We considered P<.05 (2-tailed testing) statistically significant. Correlation between the muscle mutation load and indices of oxidative capacity, ie, O2, Wmax, exercise-induced increases in plasma lactate levels, and biochemical and morphological findings from the muscle biopsy specimens, were evaluated by the Pearson product moment correlation test using Sigma Stat software (SPSS Inc, Chicago, Ill). Unless otherwise indicated, all values are expressed as mean ± SE.
RESULTS
CORRELATION BETWEEN O2max AND Wmax AND MUTATION LOAD
The mean O2max was 1905 ± 117 (range, 702-3124) mL/min and the mean Wmax was 121 ± 9 (range, 21-284) W in the 51 persons carrying the 3243A>G mtDNA mutation in muscle (Figure 1). These values were 40% and 60% lower, respectively, than in healthy controls (2731 ± 162 mL/min and 202 ± 11 W, respectively; P<.001).
The percentage of mutation in the skeletal muscle ranged from 2% to 95% (50% ± 5%). The O2max correlated inversely with the percentage of mtDNA mutation load in skeletal muscle (R = 0.64; P<.001) (Figure 1). The Wmax also correlated with the percentage of heteroplasmy in patients with mitochondrial myopathy (R = 0.61; P<.001). Besides training status and mitochondrial function, the O2max depends on sex and age. Owing to these possible influences, we adjusted the O2max for age and sex, but this correction did not improve the unadjusted correlation between the muscle mutation load and muscle oxidative capacity (R = 0.61; P<.001).
CORRELATION BETWEEN INDICES OF OXIDATIVE CAPACITY AND MUTATION LOAD IN MUSCLE AND BLOOD
The resting plasma lactate level was higher in persons with the 3243A>G mutation (18.9 ± 1.8 mg/dL [2.1 ± 0.2 mmol/L]; range, 7.2-46.0 mg/dL [0.8-5.1 mmol/L]) than in healthy controls (9.9 ± 0.9 mg/dL [1.1 ± 0.1 mmol/L]; P<.001) (Figure 2), but at peak exercise, plasma lactate levels rose to similar levels in both groups (3243A>G subjects, 70.3 ± 3.6 mg/dL [7.8 ± 0.4 mmol/L]; healthy controls, 75.7 ± 4.5 mg/dL [8.4 ± 0.5 mmol/L]). In line with the O2max, resting plasma lactate levels correlated with the mutation load in skeletal muscle (R = 0.81; P<.001) by a first polynomial order (Figure 2).
|
|
|
|
Figure 2. Correlation between the muscle mutation load and resting venous plasma lactate concentration in 51 persons (triangles) with the 3243A>G mutation of mitochondrial DNA. The cross at 0% mutation load represents the plasma lactate concentration (mean ± SE) in 20 healthy control subjects. The dotted line represents the mean value + 2 SDs found in the 20 healthy controls. To convert lactate levels to millimoles per liter, multiply by 0.111.
|
|
|
On muscle biopsy findings, 25 of the 51 persons with the 3243A>G mutation had more than 2% ragged red/blue and/or COX-negative fibers, 10 had ragged red/blue and COX-negative fibers, 11 had only ragged red/blue fibers, and 4 had only COX-negative fibers (Figure 3). The numbers of COX-negative and/or ragged red/blue fibers in muscle did not correlate with the muscle mutation load, but there was a clear cutoff mutation level at which morphological abnormalities occurred (Figure 3). Thus, all 25 persons with COX-negative and/or ragged red/blue fibers on muscle biopsy findings had mutation loads above 50% in muscle.
|
|
|
|
Figure 3. Muscle morphological findings at muscle biopsy in 51 persons with the 3243A>G mutation. The 2 dotted lines represent the lower and higher cutoff values for the skeletal muscle mutation load at which oxidative impairment emerges in persons with the 3243A>G mitochondrial DNA mutation. COX indicates cytochrome oxidase; RRFs, ragged red and/or blue fibers.
|
|
|
Overall, citrate synthasecorrected complex I to IV activities were normal in persons with the 3243A>G mtDNA mutation. Only 4 patients with myopathic symptoms showed impairment of complex I activity, and complex IV activity was impaired in only 2 (data not shown). The absolute or citrate synthasecorrected complex I to IV activities did not correlate with the muscle mutation load.
The percentage of mutant mtDNA in blood ranged from 0% to 61% (mean, 18% ± 3%). In contrast to the mutation load in muscle, the mutation load in blood did not correlate with the O2max (R = 0.23; P<.01), the resting plasma lactate levels (R = 0.81; P<.001), the level of ragged red/blue and/or COX-negative fibers on muscle biopsy findings, or the mitochondrial enzyme activity.
HEARING IMPAIRMENT, DIABETES-IMPAIRED GLUCOSE TOLERANCE, AND CLINICAL EVIDENCE OF EXERCISE INTOLERANCE
Fourteen of the 51 persons carrying the 3243A>G mutation had diabetes mellitus and hearing loss. No other person had diabetes, but an additional 5 persons had abnormal oral glucose tolerance test results (Figure 4). In total, 23 persons had hearing loss, and 13 used hearing aids. Exercise intolerance was diagnosed in 25 of the 51 persons carrying the 3243A>G mutation (Figure 4). All persons with diabetes mellitus carried more than a 65% mutation load in muscle, whereas persons with impaired glucose tolerance had a wider range of mutation load (4%-90%) (Figure 4). Similar to persons with diabetes mellitus, all persons with hearing loss carried more than a 65% mutation load in skeletal muscle (Figure 4). The 25 persons with exercise intolerance had more than 55% mutant mtDNA in muscle (Figure 4). Persons with hearing impairment, exercise intolerance, or diabetes mellitus had a higher mutation load in muscle compared with asymptomatic persons (P<.001).
|
|
|
|
Figure 4. Symptoms of exercise intolerance, impaired glucose tolerance or diabetes mellitus, and hearing impairment in 51 persons with the 3243A>G mutation. A, Symptoms as a function of the skeletal muscle mutation load. B, Symptoms as a function of blood mutation load.
|
|
|
In contrast to the tight coupling between the mutation load in muscle and symptoms from postmitotic tissues, there was no correlation between the blood mutation load and diabetes mellitus and only a weak association between the blood mutation load and hearing loss and myopathic symptoms (P<.05).
COMMENT
It has previously been shown that the type of mtDNA mutation in muscle is important for phenotypic expression of muscle symptoms.24-25 However, the functional consequences of variable mutant loads of the same mutation in skeletal muscle have never been investigated in patients with mitochondrial disease carrying a wide range of this mutant load in muscle. This study demonstrates a close relationship between the muscle phenotype and muscle mutation load in persons carrying the 3243A>G point mutation of mtDNA. We also found a relationship between mutation load in skeletal muscle and symptoms from 2 other postmitotic tissues (hearing impairment and diabetes mellitus). In contrast to this, we found no correlation or, at the very best, a weak correlation when symptoms from postmitotic tissues were compared with the mutation load in blood, which stresses the importance of comparing the phenotype and genetic abnormalities in the same tissues in disorders caused by mtDNA defects. The study also suggests that the threshold for mutant load in muscle at which symptoms emerge in persons carrying the 3243A>G mutation may be much lower than previously believed. Thus, based on histological and physiological measurements, our findings suggest that symptoms may occur at mutation loads as low as 50%, a figure that is 40% lower than that found in vitro.3
The variable distribution of mutant load among tissues in mitochondrial disease and the weak genotype-phenotype relationship that has previously been found in these conditions has made genetic counseling difficult. Many studies investigating genotype-phenotype relationships in mitochondrial disease have compared mtDNA mutation load in blood with symptoms from postmitotic tissues5-6,8, 15-16,19-20 and found a weak or no correlation. This lack of correlation might be explained by the tissue-specific, differential, postnatal change in the mutation load with time, as has been reported for most transfer RNA mtDNA mutations.26-30 Although there is evidence that the mutation load increases with time in postmitotic tissues,26-28,30 findings in mitotic tissues such as blood and epithelial cells31-34 indicate that the level of mutant mtDNA decreases with time.
Although the mutation load may differ considerably among mitotic and postmitotic tissues, postmortem findings indicate that the mutation load in postmitotic tissues (skeletal muscle and nervous and cochlear tissues) is similar.35-38 It is therefore surprising that studies correlating the mutation load in skeletal muscle with the phenotype in other postmitotic tissues have not been able to find a relationship. The lack of such an association may be explained by (1) comparison of old clinical information with new genetic findings11, 19; (2) use of retrospective data for comparison13, 18; (3) use of too small a sample size8-9,15-17,19; (4) investigation of phenotypes in patients carrying a narrow range of the mutation load in muscle (all >80%)12; and (5) the pooling of symptoms from different tissues for comparison.6, 10, 16 These problems, alone or in combination, seriously interfere with the interpretation of genotype-phenotype relationships in mitochondrial disease and have produced seemingly odd results, such as decreasing myopathy and exercise intolerance with increasing mutant load in muscle.5, 8, 10-11,13
In our study, we found a close correlation between the muscle mutation load and muscle phenotype; in addition, we found a close correlation between the muscle mutation load and symptoms from 2 other postmitotic tissues. Thus, all persons with hearing impairment and/or diabetes mellitus carried a mutation load above 65% in muscle (Figure 4). Although our findings on the correlation between the muscle mutation load and symptoms from other postmitotic tissues contradict a number of other studies, a correlation between hearing impairment and the muscle mutation load has been described in 8 and 38 persons carrying the 3243A>G mutation.39-40
Plasma lactate comes primarily from skeletal muscle.41 In adult patients with mitochondrial disease, the resting lactate level is always within reference limits after a night's rest in a bed.42 Therefore, elevated resting plasma lactate levels in mitochondrial myopathy are always a result of previous exercise, and resting plasma lactate levels are therefore an index of oxidative capacity in line with the O2max. Similar to the O2max, resting plasma lactate levels in this study correlated inversely with the muscle mutation load in persons carrying the 3243A>G mtDNA mutation (Figure 2).
It is well known that persons carrying the 3243A>G mutation can have impaired complex I and, more rarely, complex IV activities.5-6,11 In this study, only 4 persons with the 3243A>G mutation had impaired complex I activity, and 2 of these persons also had decreased complex IV activity. Complex activities did not correlate with muscle mutation load, which is in agreement with other studies investigating other mtDNA mutations,12, 19 whereas 1 study of the 3243A>G mutation found a correlation with complex I.11
Based on in vitro findings, it is generally believed that the mtDNA mutation load needs to exceed a certain threshold before symptoms emerge. This mtDNA mutation load threshold has been difficult to investigate in vivo because it requires a large number of persons carrying the same mtDNA mutation and a wide range of the mutation load. In this study, we recruited relatives of the probands with mitochondrial disease and thereby achieved a wide range of mtDNA mutation load in the studied cohort. Impaired O2max and ragged red/blue and COX-negative fibers were found in persons with a muscle mutation load of as low as 50% (Figures 1 and 3), and only 4 of 28 persons carrying a muscle mutation load above 50% had a O2max within reference limits and normal muscle morphological findings. These findings suggest that the mutation level at which oxidative impairment and muscle symptoms occur seems to be as low as 50% to 65% in persons carrying the 3243A>G mutation. This threshold is more than 30% lower than that suggested by cell culture studies and 10% to 20% lower than that suggested by in vivo studies.24-25
AUTHOR INFORMATION
Correspondence: Tina D. Jeppesen, MD, Neuromuscular Research Unit, Section 7611, Rigshospitalet, Blegdamsvej 9, DK-2100 Copenhagen, Denmark (dysgaard{at}rh.dk).
Accepted for Publication: November 17, 2005.
Author Contributions: Study concept and design: Jeppesen and Vissing. Acquisition of data: Jeppesen, Schwartz, Frederiksen, Wibrand, and Olsen. Analysis and interpretation of data: Jeppesen, Schwartz, Wibrand, and Vissing. Drafting of the manuscript: Jeppesen, Schwartz, Wibrand, and Vissing. Critical revision of the manuscript for important intellectual content: Frederiksen, Olsen, and Vissing. Statistical analysis: Jeppesen. Obtained funding: Jeppesen, Schwartz, and Vissing. Administrative, technical, and material support: Jeppesen, Schwartz, Frederiksen, Wibrand, Olsen, and Vissing. Study supervision: Vissing.
Financial Disclosure: None reported.
Funding/Support: This study was supported by grants from the Copenhagen Hospital Community Foundation, NOVO Nordic Foundation, P. Carl Pedersen Foundation, and Vilhelm Pedersen and Wife's Foundation and grants 22-00-1056 and 22-03-0474 from the Danish Medical Research Council.
Author Affiliations: Copenhagen Muscle Research Center (Drs Jeppesen, Olsen, and Vissing), Department of Neurology and Neuromuscular Research Unit (Drs Jeppesen, Olsen, and Vissing), and Department of Clinical Genetics (Dr Schwartz), National University Hospital, Rigshospitalet, Copenhagen, Denmark; Department of Endocrinology, Ribe County Hospital, Esbjerg, Denmark (Dr Frederiksen); and J. F. Kennedy Institute, Glostrup, Denmark (Dr Wibrand).
REFERENCES
 |  |
1. Holt IJ, Cooper JM, Morgan-Hughes JA, Harding AE. Deletions of muscle mitochondrial DNA [letter]. Lancet. 1988;1:1462.
ISI
| PUBMED
2. Wallace DC, Singh G, Lott MT, et al. Mitochondrial DNA mutation associated with Leber's hereditary optic neuropathy. Science. 1988;242:1427-1430.
FREE FULL TEXT
3. Chomyn A, Martinuzzi A, Yoneda M, et al. MELAS mutation in mtDNA binding site for transcription termination factor causes defects in protein synthesis and in respiration but no change in levels of upstream and downstream mature transcripts. Proc Natl Acad Sci U S A. 1992;89:4221-4225.
FREE FULL TEXT
4. Karppa M, Herva R, Moslemi AR, Oldfors A, Kakko S, Majamaa K. Spectrum of myopathic findings in 50 patients with the 3243A>G mutation in mitochondrial DNA. Brain. 2005;128:1861-1869.
FREE FULL TEXT
5. Yamamoto M, Clemens PR, Engel AG. Mitochondrial DNA deletions in mitochondrial cytopathies: observations in 19 patients. Neurology. 1991;41:1822-1828.
FREE FULL TEXT
6. Ciafaloni E, Ricci E, Shanske S, et al. MELAS: clinical features, biochemistry, and molecular genetics. Ann Neurol. 1992;31:391-398.
FULL TEXT
|
ISI
| PUBMED
7. Martinuzzi A, Bartolomei L, Carrozzo R, et al. Correlation between clinical and molecular features in two MELAS families. J Neurol Sci. 1992;113:222-229.
FULL TEXT
|
ISI
| PUBMED
8. Liou CW, Huang CC, Chee EC, et al. MELAS syndrome: correlation between clinical features and molecular genetic analysis. Acta Neurol Scand. 1994;90:354-359.
ISI
| PUBMED
9. Campos Y, Bautista J, Gutierrez-Rivas E, et al. Clinical heterogeneity in two pedigrees with the 3243 bp tRNA(Leu(UUR)) mutation of mitochondrial DNA. Acta Neurol Scand. 1995;91:62-65.
ISI
| PUBMED
10. Hammans SR, Sweeney MG, Hanna MG, Brockington M, Morgan-Hughes JA, Harding AE. The mitochondrial DNA transfer RNALeu(UUR) A G(3243) mutation: a clinical and genetic study. Brain. 1995;118:721-734.
FREE FULL TEXT
11. Mariotti C, Savarese N, Suomalainen A, et al. Genotype to phenotype correlations in mitochondrial encephalomyopathies associated with the A3243G mutation of mitochondrial DNA. J Neurol. 1995;242:304-312.
FULL TEXT
|
ISI
| PUBMED
12. Ozawa M, Goto Y, Sakuta R, Tanno Y, Tsuji S, Nonaka I. The 8344 mutation in mitochondrial DNA: a comparison between the proportion of mutant DNA and clinico-pathologic findings. Neuromuscul Disord. 1995;5:483-488.
FULL TEXT
|
ISI
| PUBMED
13. Chinnery PF, Howell N, Lightowlers RN, Turnbull DM. Molecular pathology of MELAS and MERRF: the relationship between mutation load and clinical phenotypes. Brain. 1997;120:1713-1721.
FREE FULL TEXT
14. Kiyomoto BH, Tengan CH, Moraes CT, Oliveira AS, Gabbai AA. Mitochondrial DNA defects in Brazilian patients with chronic progressive external ophthalmoplegia. J Neurol Sci. 1997;152:160-165.
FULL TEXT
|
ISI
| PUBMED
15. Uziel G, Moroni I, Lamantea E, et al. Mitochondrial disease associated with the T8993G mutation of the mitochondrial ATPase 6 gene: a clinical, biochemical, and molecular study in six families. J Neurol Neurosurg Psychiatry. 1997;63:16-22.
FREE FULL TEXT
16. Dubeau F, De Stefano N, Zifkin BG, Arnold DL, Shoubridge EA. Oxidative phosphorylation defect in the brains of carriers of the tRNALeu(UUR) A3243G mutation in a MELAS pedigree. Ann Neurol. 2000;47:179-185.
FULL TEXT
|
ISI
| PUBMED
17. Koga Y, Akita Y, Takane N, Sato Y, Kato H. Heterogeneous presentation in A3243G mutation in the mitochondrial tRNALeu(UUR) gene. Arch Dis Child. 2000;82:407-411.
FREE FULL TEXT
18. Sciacco M, Prelle A, Comi GP, et al. Retrospective study of a large population of patients affected with mitochondrial disorders: clinical, morphological and molecular genetic evaluation. J Neurol. 2001;248:778-788.
FULL TEXT
|
ISI
| PUBMED
19. Carelli V, Baracca A, Barogi S, et al. Biochemical-clinical correlation in patients with different loads of the mitochondrial DNA T8993G mutation. Arch Neurol. 2002;59:264-270.
FREE FULL TEXT
20. Huang CC, Kuo HC, Chu CC, Liou CW, Ma YS, Wei YH. Clinical phenotype, prognosis and mitochondrial DNA mutation load in mitochondrial encephalomyopathies. J Biomed Sci. 2002;9:527-533.
FULL TEXT
|
ISI
| PUBMED
21. Suomalainen A, Syvanen AC. Quantitative analysis of human DNA sequences by PCR and solid-phase minisequencing. Mol Biotechnol. 2000;15:123-131.
FULL TEXT
|
ISI
| PUBMED
22. Schwartz M, Vissing J. Paternal inheritance of mitochondrial DNA. N Engl J Med. 2002;347:576-580.
FREE FULL TEXT
23. Wibrand F, Ravn K, Schwartz M, Rosenberg T, Horn N, Vissing J. Multisystem disorder associated with a missense mutation in the mitochondrial cytochrome b gene. Ann Neurol. 2001;50:540-543.
FULL TEXT
|
ISI
| PUBMED
24. Jeppesen TD, Schwartz M, Olsen D, Vissing J. Oxidative capacity correlates with muscle mutation load in mitochondrial myopathy. Ann Neurol. 2003;54:86-92.
FULL TEXT
|
ISI
| PUBMED
25. Taivassalo T, Jensen TD, Kennaway N, DiMauro S, Vissing J, Haller RG. The spectrum of exercise tolerance in mitochondrial myopathies: a study of 40 patients. Brain. 2003;126:413-423.
FREE FULL TEXT
26. Moraes CT, Schon EA, DiMauro S, Miranda AF. Heteroplasmy of mitochondrial genomes in clonal cultures from patients with Kearns-Sayre syndrome. Biochem Biophys Res Commun. 1989;160:765-771.
FULL TEXT
|
ISI
| PUBMED
27. Larsson NG, Holme E, Kristiansson B, Oldfors A, Tulinius M. Progressive increase of the mutated mitochondrial DNA fraction in Kearns-Sayre syndrome. Pediatr Res. 1990;28:131-136.
ISI
| PUBMED
28. Weber K, Wilson JN, Taylor L, et al. A new mtDNA mutation showing accumulation with time and restriction to skeletal muscle. Am J Hum Genet. 1997;60:373-380.
ISI
| PUBMED
29. Hanna MG, Nelson IP, Morgan-Hughes JA, Wood NW. MELAS: a new disease associated mitochondrial DNA mutation and evidence for further genetic heterogeneity. J Neurol Neurosurg Psychiatry. 1998;65:512-517.
FREE FULL TEXT
30. Chinnery PF, Howel D, Turnbull DM, Johnson MA. Clinical progression of mitochondrial myopathy is associated with the random accumulation of cytochrome c oxidase negative skeletal muscle fibres. J Neurol Sci. 2003;211:63-66.
FULL TEXT
|
ISI
| PUBMED
31. 't Hart LM, Jansen JJ, Lemkes HH, de Knijff P, Maassen JA. Heteroplasmy levels of a mitochondrial gene mutation associated with diabetes mellitus decrease in leucocyte DNA upon aging. Hum Mutat. 1996;7:193-197.
FULL TEXT
|
ISI
| PUBMED
32. Jacobi FK, Leo-Kottler B, Mittelviefhaus K, et al. Segregation patterns and heteroplasmy prevalence in Leber's hereditary optic neuropathy. Invest Ophthalmol Vis Sci. 2001;42:1208-1214.
FREE FULL TEXT
33. Rahman S, Poulton J, Marchington D, Suomalainen A. Decrease of 3243A G mtDNA mutation from blood in MELAS syndrome: a longitudinal study. Am J Hum Genet. 2001;68:238-240.
FULL TEXT
|
ISI
| PUBMED
34. Kaplanova V, Zeman J, Hansikova H, et al. Segregation pattern and biochemical effect of the G3460A mtDNA mutation in 27 members of LHON family. J Neurol Sci. 2004;223:149-155.
FULL TEXT
|
ISI
| PUBMED
35. Shiraiwa N, Ishii A, Iwamoto H, Mizusawa H, Kagawa Y, Ohta S. Content of mutant mitochondrial DNA and organ dysfunction in a patient with a MELAS subgroup of mitochondrial encephalomyopathies. J Neurol Sci. 1993;120:174-179.
FULL TEXT
|
ISI
| PUBMED
36. Macmillan C, Lach B, Shoubridge EA. Variable distribution of mutant mitochondrial DNAs (tRNALeu[3243]) in tissues of symptomatic relatives with MELAS: the role of mitotic segregation. Neurology. 1993;43:1586-1590.
FREE FULL TEXT
37. White SL, Collins VR, Wolfe R, et al. Genetic counseling and prenatal diagnosis for the mitochondrial DNA mutations at nucleotide 8993. Am J Hum Genet. 1999;65:474-482.
FULL TEXT
|
ISI
| PUBMED
38. Damian MS, Seibel P, Reichmann H, et al. Clinical spectrum of the MELAS mutation in a large pedigree. Acta Neurol Scand. 1995;92:409-415.
ISI
| PUBMED
39. Chinnery PF, Elliott C, Green GR, et al. The spectrum of hearing loss due to mitochondrial DNA defects. Brain. 2000;123:82-92.
FREE FULL TEXT
40. Uimonen S, Moilanen JS, Sorri M, Hassinen IE, Majamaa K. Hearing impairment in patients with 3243A G mtDNA mutation: phenotype and rate of progression. Hum Genet. 2001;108:284-289.
FULL TEXT
|
ISI
| PUBMED
41. Van Hall G. Lactate as a fuel for mitochondrial respiration. Acta Physiol Scand. 2000;168:643-656.
FULL TEXT
|
ISI
| PUBMED
42. Jeppesen TD, Olsen D, Vissing J. Cycle ergometry is not a sensitive diagnostic test for mitochondrial myopathy. J Neurol. 2003;250:293-299.
FULL TEXT
|
ISI
| PUBMED
CiteULike Connotea Del.icio.us Digg Reddit Technorati
What's this?
RELATED ARTICLE
Pedaling From Genotype to Phenotype
Salvatore DiMauro and Michio Hirano
Arch Neurol. 2006;63(12):1679-1680.
EXTRACT
| FULL TEXT
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES
Fat Metabolism During Exercise in Patients With Mitochondrial Disease
Jeppesen et al.
Arch Neurol 2009;66:365-370.
ABSTRACT
| FULL TEXT
Pedaling From Genotype to Phenotype
DiMauro and Hirano
Arch Neurol 2006;63:1679-1680.
FULL TEXT
|