You are seeing this message because your Web browser does not support basic Web standards. Find out more about why this message is appearing and what you can do to make your experience on this site better.


ABOUT ARCHIVES
Advanced Search

Welcome   | My Account | E-mail Alerts | Access Rights | Sign In


  Vol. 61 No. 11, November 2004 TABLE OF CONTENTS
  Archives
  •  Online Features
  Observation
 This Article
 •Abstract
 •PDF
 • Reply to article
 •Send to a friend
 • Save in My Folder
 •Save to citation manager
 •Permissions
 Citing Articles
 •Citation map
 •Citing articles on HighWire
 •Citing articles on ISI (19)
 •Contact me when this article is cited
 Related Content
 •Similar articles in this journal
 Topic Collections
 •Neurogenetics
 •Movement Disorders
 •Neuro-ophthalmology
 •Parkinson Disease/ Parkinsonian Disorders
 •Alert me on articles by topic

A Novel Polymerase {gamma} Mutation in a Family With Ophthalmoplegia, Neuropathy, and Parkinsonism

Michelangelo Mancuso, MD; Massimiliano Filosto, MD; Shin J. Oh, MD; Salvatore DiMauro, MD

Arch Neurol. 2004;61:1777-1779.

ABSTRACT

Background  Mutations in polymerase {gamma} cause progressive external ophthalmoplegia and a variety of associated symptoms and signs, including neuropathy, ataxia, hypogonadism, hearing loss, muscle weakness, and psychiatric problems. Extrapyramidal signs have been rarely described.

Objective  To describe a family with a novel polymerase {gamma} mutation and autosomal dominant transmission of progressive external ophthalmoplegia, neuropathy, hypogonadism, and parkinsonism.

Design  Case report.

Patients  The proband, a 49-year-old woman with incipient parkinsonism, and her 59-year-old brother with overt parkinsonian features.

Main Outcome Measures  Mutation in the proband by sequencing the polymerase {gamma} gene and in affected relatives by restriction fragment length polymorphism analysis.

Results  We found multiple mitochondrial DNA deletions in the proband’s muscle and a novel missense mutation in the polymerase {gamma} gene (A2492G) in the proband and in her affected siblings.

Conclusion  Parkinsonism was a prominent clinical feature in this family with autosomal dominant ophthalmoplegia, multiple mitochondrial DNA deletions, and a novel mutation in the polymerase {gamma} gene.



INTRODUCTION
 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

Mutations in 3 nuclear genes, adenine nucleotide translocator-1 (ANT1), chromosome 10 open reading frame 2 (C10orf2) encoding Twinkle helicase, and polymerase {gamma} (POLG), have been associated with autosomal progressive external ophthalmoplegia (PEO) and multiple deletions in mitochondrial DNA (mtDNA).1 Mutations in POLG cause heterogeneous and usually severe clinical phenotypes and may be associated with either dominant or recessive PEO.2-8 In addition to PEO, common manifestations of POLG mutations include neuropathy, ataxia, hypogonadism, migraine, hearing loss, muscle weakness, and psychiatric symptoms. Extrapyramidal signs are rarely associated with primary mtDNA mutations and have not been reported in patients with POLG mutations.

We describe a family in which parkinsonism was a prominent manifestation together with PEO. The syndrome was caused by a novel POLG mutation, suggesting that the dopaminergic nigrostriatal system can be a target of mitochondrial dysfunction. 


METHODS
 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

The proband (case III-1) (Figure 1), a 49-year-old woman, noticed progressive bilateral ptosis and diplopia from the age of 28 years. She also complained of weakness in both arms and legs and of exercise intolerance. A neurological examination at 44 years of age showed nearly complete ophthalmoplegia, severe bilateral ptosis, and mild weakness of neck flexion. Results of a needle electromyogram in the limb muscle were normal. Results of a fundoscopic examination and the patient’s hearing were normal. At 45 years of age, she was found to have sensory neuropathy. There was decreased vibratory sensation in the toes and decreased pinprick sensation below the ankles. Proprioception was normal. Deep tendon reflexes were normal except for absent ankle reflexes, and Romberg sign was absent. A nerve conduction study showed mild axonal neuropathy. At age 47 years, she developed slowly progressive resting hand tremor, slowing of her gait, bradykinesia, rigidity, and slurred speech. Results of magnetic resonance imaging of the brain were normal. She had a history of hypertension and gonadal dysgenesis. Findings from laboratory studies were normal, except for low serum free and total carnitine level. Present medications include amantadine, selegiline, levodopa, coenzyme Q, levocarnitine, and clonidine.



View larger version (19K):
[in this window]
[in a new window]
Figure 1. Pedigree of the family. Individuals with parkinsonism are represented by stippled symbols, symptomatic individuals without parkinsonism by solid symbols, and asymptomatic individuals by open symbols. Arrow indicates the index case; circles, women; slashed symbols, deceased subjects; and squares, men.


The patient’s 59-year-old brother (III-2) developed parkinsonism in his early 40s. Family history data revealed that the proband’s father (II-1), a paternal cousin (III-6), and the cousin’s daughter (IV-4) had PEO and exercise intolerance. Interestingly, several paternal relatives (II-1, III-4, III-5, IV-1, IV-3, and V-2) suffered from congenital cataract but had normal neurological examination results.

MUSCLE MORPHOLOGY AND ENZYME ASSAYS

In a muscle biopsy from the proband, we performed a histochemical analysis of serial frozen sections and measured mitochondrial enzyme activities in muscle extracts by described methods.9-10

MOLECULAR GENETIC ANALYSIS

Southern blot analysis on DNA extracted from the proband’s muscle was performed as described.11 The entire coding regions of the POLG, ANT1, and Twinkle genes were amplified and sequenced as reported.5

Polymerase chain reaction and restriction fragment length polymorphism analyses were performed to confirm the mutation in DNA from the proband’s muscle and from the blood of several relatives (III-2, III-5, IV-1, IV-2, V-1, and V-2). We used the primers F-5' mismatch ACCCCACCAGGCACCCCGACC and R-5' GGGAGAGGAAGAGCAGGGGCC. Polymerase chain reaction conditions were 94°C for 3 minutes, followed by 35 cycles at 94°C for 1 minute, 64°C for 1 minute, 72°C for 1 minute, and a final extension step at 72°C for 7 minutes. The restriction enzyme BsiEI cuts only mutant DNA.


RESULTS
 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

A histochemical examination of the proband’s muscle biopsy showed numerous ragged-red fibers with the modified Gomori trichrome stain and cytochrome-c oxidase–negative fibers with the cytochrome-c oxidase–succinate dehydrogenase stain.

Biochemical studies showed markedly increased citrate synthase activity, a good indicator of mitochondrial proliferation. When referred to citrate synthase, residual activities of respiratory chain complexes were as follows: complex I, 77%; complex III, 69%; and complex IV (cytochrome-c oxidase), 54%. In contrast, the activity of complex II was 121% of normal.

Southern blot analysis of DNA from the proband’s muscle showed multiple deletions of mtDNA. Screening of ANT1 and Twinkle genes did not show any mutation, whereas direct sequencing of the POLG gene revealed a heterozygous transition (A2492G) in exon 16, changing an encoded tyrosine to a cysteine at amino acid position 831 (Y831C) (Figure 2A).



View larger version (91K):
[in this window]
[in a new window]
Figure 2. Electropherogram and polymerase chain reaction–restriction fragment length polymorphism analyses of the mutations. A, Heterozygous mutation A2492G in exon 16 (arrow). B, The restriction endonuclease BsiEI cuts the 170–base pair (bp) mutant DNA fragment into 2 fragments of 151 bp and 19 bp (smaller fragment not shown). C indicates control; M, molecular marker; and P, patient.


Restriction fragment length polymorphism confirmed the presence of the heterozygous change in the 2 affected siblings (III-1 and III-2) but not in unaffected relatives (III-5, IV-1, IV-2, V-1, and V-2) or in 130 healthy controls.


COMMENT
 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

We report a novel heterozygous missense change (A2492G) in the POLG gene in a family with autosomal dominant PEO, peripheral neuropathy, and—notably—parkinsonism. We consider this mutation pathogenic for several reasons. First, it is consistent with the clinical manifestation of PEO and peripheral neuropathy. Second, the mutated amino acid (Tyr831) is very close to motif A in the polymerase region of POLG encoding the {alpha} subunit, and most reported pathogenic mutations in POLG affect either the exonuclease or the polymerase domain.2-8 Third, this mutation was not found in 130 controls.

Although parkinsonism was not among the clinical features of the first reported patients with POLG mutations, it may be an important, albeit inconsistent, manifestation of these genetic defects because it was a prominent feature in 5 other families (Anu Suomalainen, MD, oral and written communication, 2004). The hypothesis of a mitochondrial role in the pathogenesis of idiopathic Parkinson disease was introduced by the report of parkinsonism induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, an inhibitor of complex I,12 and was bolstered by findings that complex I activity was decreased in the substantia nigra of patients with Parkinson disease.13 Although the role of mitochondrial dysfunction and mtDNA mutations in the pathogenesis of Parkinson disease remains controversial, parkinsonism has been associated with several mtDNA mutations, including large-scale rearrangements14-17 and point mutations or microdeletions.18-19 On the contrary, specific mitochondrial polymorphisms seem to reduce the risk of Parkinson disease.20

Congenital cataract is not a typical sign of POLG mutation: its occurrence in several members of this family, who had no neurological problems and no mutation in POLG, may be coincidental because there are several forms of congenital cataracts due to different genetic defects.21

Our findings confirm that the clinical manifestations of POLG mutations are more heterogeneous than those due to mutations in ANT1 or C10orf2. Parkinsonism should be added to PEO, psychiatric disorders, dysphagia, neuropathy, hypogonadism, and ataxia as another feature of POLG mutations. Conversely, POLG mutations should be considered in the differential diagnosis of parkinsonism, especially in families with autosomal dominant transmission.


AUTHOR INFORMATION
 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

Correspondence: Salvatore DiMauro, MD, 4-420 College of Physicians and Surgeons, 630 West 168th St, New York, NY (sd12{at}columbia.edu).

Accepted for Publication: February 19, 2004.

Author Contributions: Study concept and design: Mancuso, Filosto, Oh, and DiMauro. Acquisition of data: Filosto and DiMauro. Analysis and interpretation of data: Mancusoand DiMauro. Drafting of the manuscript: Mancuso, Filosto, and DiMauro. Critical revision of the manuscript for important intellectual content: Oh. Obtained funding: DiMauro.Administrative, technical, and material support: Filosto. Study supervision: Mancuso and DiMauro.

Funding/Support: This study was supported by grants NS11766 and PO1HD 32062 from the National Institutes of Health, Bethesda, Md, and by a grant from the Muscular Dystrophy Association, Tucson, Ariz. Dr Mancuso is supported by the Department of Neurosciences, University of Pisa, Pisa, Italy. Dr Filosto is supported by the Department of Neurological Sciences and Vision, University of Verona, Verona, Italy.

Author Affiliations: Department of Neurology, Columbia University College of Physicians and Surgeons, New York, NY (Drs Mancuso, Filosto, and DiMauro), and Department of Neurology, University of Alabama at Birmingham (Dr Oh).


REFERENCES
 Jump to Section
 •Top
 •Introduction
 •Methods
 •Results
 •Comment
 •Author information
 •References

1. Hirano M, DiMauro S. ANT1, Twinkle, POLG, and TP: new genes open our eyes to ophthalmoplegia. Neurology. 2001;57:2163-2165. FREE FULL TEXT
2. Lamantea E, Tiranti V, Bordoni A, et al. Mutations of mitochondrial DNA polymerase gA are a frequent cause of autosomal dominant or recessive progressive external ophthalmoplegia. Ann Neurol. 2002;52:211-219. FULL TEXT | ISI | PUBMED
3. Van Goethem G, Martin JJ, Dermaut B, et al. Recessive POLG mutations presenting with sensory and ataxic neuropathy in compound heterozygote patients with progressive external ophthalmoplegia. Neuromuscul Disord. 2003;13:133-142. FULL TEXT | ISI | PUBMED
4. Agostino A, Valletta L, Chinnery PF, et al. Mutations of ANT1, Twinkle, and POLG1 in sporadic progressive external ophthalmoplegia (PEO). Neurology. 2003;60:1354-1356. FREE FULL TEXT
5. Filosto M, Mancuso M, Nishigaki Y, et al. Clinical and genetic heterogeneity in progressive external ophthalmoplegia due to mutations in polymerase gamma. Arch Neurol. 2003;60:1279-1284. FREE FULL TEXT
6. Mancuso M, Filosto M, Bellan M, et al. POLG mutation causing ophthalmoplegia, sensorimotor polyneuropathy, ataxia, and deafness. Neurology. 2004;62:316-318. FREE FULL TEXT
7. Di Fonzo A, Bordoni A, Crimi M, et al. POLG mutations in sporadic mitochondrial disorders with multiple mtDNA deletions. Hum Mutat. 2003;22:498-499. PUBMED
8. Van Goethem G, Schwartz M, Lofgren A, et al. Novel POLG mutations in progressive external ophthalmoplegia mimicking mitochondrial neurogastrointestinal encephalomyopathy. Eur J Hum Genet. 2003;11:547-549. FULL TEXT | ISI | PUBMED
9. Sciacco M, Bonilla E. Cytochemistry and immunocytochemistry of mitochondria in tissue sections. Methods Enzymol. 1996;264:509-521. PUBMED
10. DiMauro S, Servidei S, Zeviani M, et al. Cytochrome c oxidase deficiency in Leigh syndrome. Ann Neurol. 1987;22:498-506. FULL TEXT | ISI | PUBMED
11. Zeviani M, Moraes CT, DiMauro S, et al. Deletions of mitochondrial DNA in Kearns-Sayre syndrome. Neurology. 1988;38:1339-1346. FREE FULL TEXT
12. Vyas I, Heikkila RE, Nicklas WJ. Studies on the neurotoxicity of 1-methyl-4-phenyl-1,2,5,6-tetrahydropiridine: inhibition of NAD-linked substrate oxidation by its metabolite 1-methyl-4-pyridinium. J Neurochem. 1986;46:1501-1507. FULL TEXT | ISI | PUBMED
13. Schapira AH, Cooper JM, Dexter D, Jenner P, Clark JB, Marsden CD. Mitochondrial complex I deficiency in Parkinson’s disease. Lancet. 1989;1:1269. ISI | PUBMED
14. Chalmers RM, Brockington M, Howard RS, et al. Mitochondrial encephalopathy with multiple mitochondrial DNA deletions: a report of two families and two sporadic cases with unusual clinical and neuropathological features. J Neurol Sci. 1996;143:41-45. FULL TEXT | PUBMED
15. Siciliano G, Mancuso M, Ceravolo R, et al. Mitochondrial DNA rearrangements in young onset parkinsonism: two case reports. J Neurol Neurosurg Psychiatry. 2001;71:685-687. FREE FULL TEXT
16. Casali C, Bonifati V, Santorelli FM, et al. Mitochondrial myopathy, parkinsonism, and multiple mtDNA deletions in a Sephardic Jewish family. Neurology. 2001;56:802-805. FREE FULL TEXT
17. Kosel S, Grasbon-Frodl EM, Mautsch U, et al. Novel mutations of mitochondrial complex I in pathologically proven Parkinson disease. Neurogenetics. 1998;1:197-204. PUBMED
18. Thyagarajan D, Bressman S, Bruno C, et al. A novel mitochondrial 12S rRNA point mutation in Parkinsonism, deafness and neuropathy. Ann Neurol. 2000;48:730-736. FULL TEXT | PUBMED
19. De Coo IFM, Renier WO, Ruitenbeek W, et al. A 4-base pair deletion in the mitochondrial cytochrome b gene associated with Parkinsonism/MELAS overlap syndrome. Ann Neurol. 1999;45:130-133. FULL TEXT | ISI | PUBMED
20. van der Walt JM, Nicodemus KK, Martin ER, et al. Mitochondrial polymorphisms significantly reduce the risk of Parkinson disease. Am J Hum Genet. 2003;72:804-811. FULL TEXT | ISI | PUBMED
21. Klopp N, Heon E, Billingsley G, et al. Further genetic heterogeneity for autosomal dominant human sutural cataracts. Ophthalmic Res. 2003;35:71-77. FULL TEXT | ISI | PUBMED


THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES

The DNA polymerase {gamma} Y955C disease variant associated with PEO and parkinsonism mediates the incorporation and translesion synthesis opposite 7,8-dihydro-8-oxo-2'-deoxyguanosine
Graziewicz et al.
Hum Mol Genet 2007;16:2729-2739.
ABSTRACT | FULL TEXT  

Mitochondrial DNA polymerase gamma variants in idiopathic sporadic Parkinson disease
Luoma et al.
Neurology 2007;69:1152-1159.
ABSTRACT | FULL TEXT  

Familial Parkinsonism and Ophthalmoplegia From a Mutation in the Mitochondrial DNA Helicase Twinkle
Baloh et al.
Arch Neurol 2007;64:998-1000.
ABSTRACT | FULL TEXT  

Mutation of the Linker Region of the Polymerase {gamma}-1 (POLG1) Gene Associated With Progressive External Ophthalmoplegia and Parkinsonism
Hudson et al.
Arch Neurol 2007;64:553-557.
ABSTRACT | FULL TEXT  

Parkinson syndrome, neuropathy, and myopathy caused by the mutation A8344G (MERRF) in tRNALys
Horvath et al.
Neurology 2007;68:56-58.
ABSTRACT | FULL TEXT  

POLG1 in idiopathic Parkinson disease
Tiangyou et al.
Neurology 2006;67:1698-1700.
ABSTRACT | FULL TEXT  

Mitochondrial DNA polymerase-{gamma} and human disease
Hudson and Chinnery
Hum Mol Genet 2006;15:R244-R252.
ABSTRACT | FULL TEXT  

Functional defects due to spacer-region mutations of human mitochondrial DNA polymerase in a family with an ataxia-myopathy syndrome
Luoma et al.
Hum Mol Genet 2005;14:1907-1920.
ABSTRACT | FULL TEXT  





HOME | CURRENT ISSUE | PAST ISSUES | TOPIC COLLECTIONS | CME | SUBMIT | SUBSCRIBE | HELP
CONDITIONS OF USE | PRIVACY POLICY | CONTACT US | SITE MAP
 
© 2004 American Medical Association. All Rights Reserved.