 |
|
A Splice-Site Mutation in GABRG2 Associated With Childhood Absence Epilepsy and Febrile Convulsions
Colette Kananura, MS;
Karsten Haug, MD;
Thomas Sander, MD;
Uwe Runge, MD;
Wenli Gu, MS;
Kerstin Hallmann, MS;
Johannes Rebstock, MD;
Armin Heils, MD;
Ortrud K. Steinlein, MD
Arch Neurol. 2002;59:1137-1141.
ABSTRACT
| |
Context Missense mutations in the GABRG2 gene, which
encodes the  2 subunit of central nervous -aminobutyric acid
(GABA)A receptors, have recently been described in 2 families with
idiopathic epilepsy. In one of these families, the affected individuals predominantly
exhibited childhood absence epilepsy and febrile convulsions.
Objective To assess the role of GABRG2 in the genetic
predisposition to idiopathic absence epilepsies.
Design The GABRG2 gene was screened by single-strand
conformation analysis for mutations. Furthermore, a population-based association
study assessing a common exon 5 polymorphism (C588T) was carried out.
Patients The sample was composed of 135 patients with idiopathic absence epilepsy
and 154 unrelated and ethnically matched controls.
Results A point mutation (IVS6 + 2T G) leading to a splice–donor
site mutation in intron 6 was found. The mutation, which is predicted to lead
to a nonfunctional protein, cosegregates with the disease status in a family
with childhood absence epilepsy and febrile convulsions. The association study
did not find any significant differences in the allele and genotype frequencies
of the common exon 5 polymorphism (C588T) between patients with idiopathic
absence epilepsy and controls (P>.35).
Conclusions Our study identified a splice–donor-site mutation that was probably
causing a nonfunctional GABRG2 subunit. This mutation
occurred in heterozygosity in the affected members of a single nuclear family,
exhibiting a phenotypic spectrum of childhood absence epilepsy and febrile
convulsions. The GABRG2 gene seems to confer a rare
rather than a frequent major susceptibility effect to common idiopathic absence
epilepsy syndromes.
INTRODUCTION
CHILDHOOD ABSENCE epilepsy (CAE) is one of the most common subtypes
of idiopathic generalized epilepsy (IGE). It is characterized by daily clusters
of absence seizures at an age of onset between 2 and 12 years.1
Febrile convulsions (FCs) are the most common seizure subtypes, affecting
about 3% to 5% of children younger than 6 years.2-4
While CAE is often followed by other IGE syndromes, including generalized
tonic-clonic seizures and myoclonic seizures, only 3% to 7% of children suffering
from FCs develop epilepsy later in life.5
A genetic basis for both CAE and FC is well established.5
Because the incidence of FC is significantly increased in patients with CAE
(10%-15%) compared with the general population, a genetic overlap between
both of these disorders has been suggested.6
Such a common molecular basis is most obvious in the syndrome of "generalized
epilepsy with febrile seizures plus" (GEFS+), a monogenic or oligogenic
epilepsy that was first described in 1997.7
Generalized epilepsy with febrile seizures plus is characterized by FCs that
may persist beyond the age of 6 years and are often followed by generalized
seizures, including myoclonic and absence seizures.8
While the molecular basis of common forms of seizure disorders, including
FC and CAE has been elusive so far, disease-causing GEFS+ mutations
have already been identified in SCN1B, SCN1A, SCN2A, and GABRG2, genes encoding neuronal sodium channel subtypes and the 2-subunit
of central nervous -aminobutyric acid (GABA)A receptors,
respectively.9-13
A potential role of the GABAergic system has often been implicated in epileptogenesis14-16; however, genetic
evidence for this hypothesis has been obtained only recently by the discovery
of different GABRG2 mutations identified in 2 families.
The phenotype in one of these families was described to be compatible with
GEFS+, but no further details regarding the seizure types observed
in the affected pedigree members were given.12
In the second family affected, individuals predominantly had CAE and FC.13 Accordingly, these findings raise the question whether
genetic variation of the GABRG2 gene confers susceptibility
to the epileptogenesis of common subtypes of idiopathic absence epilepsies
(IAEs). We therefore systematically searched for mutations and common sequence
variants in a sample comprising a total of 135 patients with IAE and performed
a population-based association study assessing a frequent silent polymorphism
(C588T) in exon 5 of the GABRG2 gene.
PATIENTS AND METHODS
PATIENTS
The study sample included 135 unrelated German patients with IAE at
the University Hospital Rudolf Virchow at the Free University of Berlin (Berlin,
Germany) and at the University Hospital of Bonn (Bonn, Germany). The sample
consisted of 59 patients with juvenile AE and 46 patients with CAE who had
at least 1 first-degree family member affected by IGE. In addition, 19 patients
with juvenile AE and 11 with CAE were included as sporadic cases. The study
protocol was approved by the local ethics committees, and written informed
consent was obtained from all participants. Diagnostic criteria for IAE (CAE
or juvenile AE) were: (1) onset with typical absence seizures; (2) age at
onset of typical absence seizures between 3 and 20 years; (3) electroencephalographic
(EEG) findings of normal background activity and paroxysmal generalized spike-wave
EEG discharges; and (4) normal intellectual and neurological status apart
from seizures. Exclusion criteria included (1) evidence for structural lesions
or metabolic or degenerative diseases of the brain; (2) atonic/astatic or
tonic seizures; (3) complex partial seizures; (4) epilepsy with myoclonic
absences; and (5) exclusively stimulus-induced seizures.17
In case of a rare mutation in the sample of patients with IAE, we assessed
the presence of the latter in a sample comprising 88 unrelated and ethnically
matched controls. For the association study, we obtained the genotype and
allele frequencies in all 135 patients as well as in 154 unrelated and ethnically
matched controls. All controls were healthy volunteers of German descent.
FAMILY 510
The 15-year-old index patient (II-1) had exhibited typical pyknoleptic
absence seizures starting at the age of 4 years (syndrome diagnosis: CAE)
and experienced 3 uncomplicated FCs at age 4 years. In addition, he had 1
generalized tonic-clonic seizure at age 10 and 1 at age 11 years. His interictal
EEG results showed 3/s generalized spike-wave discharges during resting as
well as photosensitivity. At age 12 years, he began daily treatment with 1800
mg of valproic acid and had been free of seizures since that time. His 13-year-old
sister (II-2) had 4 uncomplicated FCs at age 3 years. She exhibited typical
absence seizures and several generalized tonic-clonic seizures at age 4 years
(syndrome diagnosis: CAE). Results of her interictal EEG showed 3/s generalized
spike-wave discharges while resting. Valproic acid treatment was started and
she had been seizure-free since then. The 42-year-old father (I-1) had experienced
20 uncomplicated FCs between the ages of 3 and 6 years. From ages 6 to 15
years, he was treated with phenobarbital and ethosuximide and remained seizure-free
without antiepileptic treatment. He had no siblings and his parents had no
known history of seizures. The 43-year-old mother (I-2) reported no history
of epileptic seizures.
MUTATION SCREENING
Genomic DNA was extracted either from 10-mL aliquots of EDTA-anticoagulated
blood samples or from lymphoblastoid cell lines, using a salting-out method.18 For single-strand conformation analysis, we designed
specific primer sets amplifying all GABRG2 exons
and adjacent exon-intron boundaries (primer sequences are available on request).
Polymerase chain reactions (PCRs) were carried out in a PTC 200 (MJ Research,
Waltham, Mass), that contained a total 25-µL volume comprised of 50
ng of genomic DNA, 5 pmol each of forward and reverse primers, 200µM
each of dinucleotide triphosphate, 1.5mM of magnesium chloride, 50mM of potassium
chloride, 20mM of Tris hydrochloride (pH 8.3), and 0.1 U of Taq DNA polymerase. Polymerase chain reaction parameters were as follows:
denaturation at 95°C for 5 minutes followed by 33 cycles at 95°C for
30 seconds, annealing at 58°C to 64°C for 30 seconds, and extension
at 72°C for 30 seconds followed by a final extension step of 5 minutes
at 72°C. The obtained PCR products were denatured and run on 10% polyacrylamide
gels for 14 to 16 hours at room temperature and at 4°C, respectively.
After the run, the bands were visualized using a standard silver-staining
protocol. Polymerase chain reaction products showing aberrant patterns were
amplified again prior to direct sequencing with an ABI 377 sequencer (Applied
Biosystems, Foster City, Calif). For verification of the mutation and screening
of the control sample, we developed a restriction fragment length assay using
primers n1005 (5'ATGTGAGCTTTCCTATCTCACG) and Z n1070 (5'TGAGAGGTATTGAAAAATCCTCTA).
The resulting PCR fragment included exon 6 and adjacent sequences from introns
5 and 6. MboII (MBI Fermentas, St Leon Roth, Germany)
digests of PCR products gave the following fragments: wild type allele, 110
base pair (bp) + 90 bp + 53 bp; mutant allele, 110 bp + 75 bp + 53 bp + 15
bp.
EXON 5 POLYMORPHISM (C588T)
Exon 5 and the adjacent parts of introns 4 and 5 were amplified using
primers n1065 (5'CCATCTTATGTTTAATATCTTTCT) and n1066 (5'ACTGTAGGTGAGGGAGGATAC).
Digestion of the PCR product with restriction endonuclease TasI (MBI Fermentas) resulted in fragments of the following sizes:
99 bp + 36 bp + 17 bp + 6 bp (C-allele) and 91 bp + 36 bp + 17 bp + 8 bp +
6 bp (T-allele). The C588T polymorphism is probably identical to a previously
described and incorrectly numbered exon 5 variant.12
Allele and genotype frequencies,  2 tests, power calculations,
and the test for Hardy-Weinberg equilibrium were calculated using the SAS
computer program (SAS Institute, Cary, NC).19
A 2-tailed type I error rate of 5% was chosen for the analyses.
Reverse Transcriptase (RT) PCR
Reverse transcription PCR was performed using the Titan One Tube RT-PCR-System
(Roche Diagnostics, Mannheim, Germany) according to the manufacturer's protocol.
The following complementary DNA (cDNA) primers were designed for verification
of the wild type GABRG2 sequence: n1024, 5'GCGACACAAGATCCTGGAGGCTTTA,
n1025, 5'CCCAGGATAGGACGACAATGAGTGT. Annealing temperatures were optimal
at 65°C, and human brain RNA (Clontech, Palo Alto, Calif) was successfully
used as template. Single- and nested-PCR attempts, however, failed to amplify
the GABRG2 cDNA from total RNA derived from leukocytes.
For the prediction of possible cryptic splice–donor sites within
intron 6, the 1998 version of an online splice site predictor program was
used (http://www.fruitfly.org).
RESULTS
VERIFICATION OF THE GABRG2 WILD TYPE SEQUENCE
The GABRG2 cDNA sequence (XM_003986.2), which
had been deposited into Genbank on April 6, 2001, differed from the previous
sequence (XM_003986.1) by the presence of an additional guanine following
nucleotide position 770, which is located at the boundary between exons 6
and 7. Compared with the previous GABRG2 sequence,
the additional guanine would result in an in-frame stop codon following amino
acid position 227 upstream of the first transmembrane domain. Reverse transcriptase
PCR amplification of the respective region could not verify the extra guanine.
These results were further confirmed by amplification from genomic DNA and
direct sequencing of both the exon 6/intron 6 and intron 6/exon 7 boundaries
(data not shown).
DETECTION OF A SPLICE–DONOR SITE MUTATION IN A FAMILY WITH CAE
AND FC
The coding region and exon/intron boundaries of GABRG2 were screened by single-strand conformation analysis for mutations
in genomic DNA samples derived from 135 patients. The DNA of the index patient
(II-1) from family 510 showed aberrant electrophoresis patterns indicative
of a sequence variation in the respective PCR fragment containing exon 6.
Direct sequencing revealed a single base pair exchange at the splice–donor
site of intron 6, substituting a thymine with a guanine (IVS6 + 2TG)
(Figure 1). No further mutations
were found by screening the entire GABRG2 coding
region.
For evaluating the segregation of the IVS6 + 2TG mutation, exon
6 and the adjacent part of intron 6 were directly sequenced in all available
members of family 510. The IVS6 + 2TG mutation was found in the affected
sister and affected father of the index patient but not in the clinically
unaffected mother (Figure 1). The
mutation was also absent in 176 control chromosomes. These results were confirmed
by restriction analysis, which showed an additional MboII restriction site in the carriers of the IVS6 + 2TG mutation.
The IVS6 + 2TG mutation destroys the conserved splice site motif
(gt) of intron 6, changing it to (gg). Sequence analysis using the splice
site predictor program yielded the maximum score of 1.0 for the wild type
constitutive splice–donor mutation site of intron 6 but classified the
mutated splice site as nonfunctional. Two strong cryptic splice–donor
mutation sites were identified at positions IVS6 + 375 (score 0.98) and IVS6
+ 758 (score 0.94).
A FREQUENT POLYMORPHISM IN THE GABRG2 GENE
IS NOT ASSOCIATED WITH IAE
To further analyze the possible role of the GABRG2 gene in epileptogenesis, we determined the genotype and allele frequencies
of the exon 5 C588T polymorphism in the entire sample of 135 IAE patients
as well as in 154 controls. Power calculation showed that the employed sample
should provide a statistical power of 93.3% to detect a susceptibility factor
with a genotypic relative risk of 2.50, assuming a type I error rate of 5%
and a prevalence of the risk factor (T-allele) of 30% (SAS version 1988).
The genotype distribution did not deviate significantly from that expected
according to the Hardy-Weinberg equilibrium. The allele frequencies (21= 0.47; P = .49) and genotype
frequencies (22 = 2.09; P
= .35) did not differ significantly between patients with IAE and controls
(Table 1).
|
|
|
|
Genotype and Allele Frequencies of the GABRG2
Exon 5 Polymorphism, C588T*
|
|
|
COMMENT
The IVS6 + 2TG mutation found in family 510 destroys the 5'-splice
site of intron 6, thus preventing the correct cleavage and removal of the
intervening sequences from the pre–messenger RNA (mRNA). Since it was
not possible to amplify the GABRG2 cDNA from peripheral
blood cell templates, the effect of the mutation could not be analyzed directly.
However, based on previous studies concerned with splice–donor site
mutations (for example, 20-22) some predictions can be made. Most splice–donor
site mutations lead to (1) exon skipping, (2) use of cryptic splice sites
within the downstream intron, or, if the intron is small, to (3) intron inclusion.20 Because of the size of the GABRG2 intron 6 (approximately 38 kb), the latter is very unlikely. Alternatively,
the IVS6 + 2TG mutation could lead to the use of 1 of the 2 strong cryptic
splice sites found at positions IVS6 + 375 and IVS6 + 758. This would result
in a truncated protein due to the presence of an in-frame stop codon located
at position IVS6 + 65 (Figure 2).
However, since almost all of the major cryptic sites that have been found
to be activated by mutations are mapped within a 100-bp region from the authentic
splice sites, the use of sites located so much further downstream seem to
be less likely.21 Exon-skipping is therefore
the most plausible mutational mechanism caused by the IVS6 + 2TG mutation.
Skipping of exon 6 would lead to an RNA containing an in-frame stop codon
at the joining site of exons 5 and 7 (Figure
2). The predicted protein coded by this aberrantly spliced RNA would
be truncated upstream from the first transmembrane domain and would therefore
be predicted to be nonfunctional. Thus, we propose that the GABRG2 splice–donor site mutation reported here leads to a nonfunctional
allele, which is likely to be the primary cause for epileptic seizures in
this family.
|
|
|
|
Figure 2. Probable effect of the IVS6 +
2TG on GABRG2 structure. A, Exon 6 and the
adjacent part of intron 6, including an in-frame stop codon and 2 strong cryptic
splice–donor sites within the intron. B, Exon-intron structure of GABRG2. The intron 6-splice–donor site mutation is
indicated by the arrow. Exons are not drawn according to size. C, Schematic
representation of the probable outcome of exon 6 skipping. The excision of
introns 5 and 6 and exon 6 followed by the fusion of exons 5 and 7 would create
an in-frame stop codon. bp indicates base pair; kb, kilobase.
|
|
|
The findings reported here suggest that a novel splice mutation of the GABRG2 gene causes a nonfunctional truncation of the GABAA receptor -subunit, contributing
a major susceptibility effect to the pathogenesis of CAE and FC in a single
family. Together with 2 previously identified amino acid exchanges,12-13 this truncation mutation extends
the spectrum of GABRG2mutations that confers monogenic effects to the pathogenesis
of FC and CAE. Because the screening of 135 patients with IAE did not reveal
more than 1 functional mutation and because of the negative results obtained
in the association study, it is obvious that GABRG2
is not playing a major role in the pathogenesis of common IAE subtypes.
AUTHOR INFORMATION
Accepted for publication March 25, 2002.
This work was supported by grants Ste769/2-1 (Dr Steinlein), Sa434/2-2
(Dr Sander), and For423 (Dr Heils) from the Deutsche Forschungsgemeinschaft,
Bonn, and grants from the German Bundesministerium fuer Bildung und Forschung,
Berlin, and BONFOR, Bonn (Dr Heils). Dr Haug is also supported by the German
Volkswagenstiftung, Hanover, Germany.
Author contributions: Study concept and design (Mss Kananura, Gu, and Hallmann, and Drs Haug, Sander, Rebstock,
Heils, and Steinlein); acquisition of data (Mss Kananura,
Gu, and Hallmann, and Drs Haug, Sander, Runge, Rebstock, Heils, and Steinlein); analysis and interpretation of data (Mss Kananura,
Gu, and Hallman, and Drs Haug, Sander, Runge, Rebstock, Heils, and Steinlein); drafting of the manuscript (Mss Kananura, Gu, and
Hallmann, and Drs Haug, Sander, Runge, Rebstock, Heils, and Steinlein);
critical revision of the manuscript for important intellectual content (Mss Kananura, Gu, and Hallmann, and Drs Haug, Sander, Runge,
Rebstock, Heils, and Steinlein); statistical expertise (Ms Kananura); and administrative, technical, and material support (Mss Kananura, Gu, and Hallman, and Drs Haug, Sander, Runge, Rebstock,
Heils, and Steinlein).
Corresponding author and reprints: Ortrud K. Steinlein, MD, Institute
of Human Genetics, University Hospital Bonn, Wilhelmstr 31, D-53111 Bonn,
Germany (e-mail: ortrud.steinlein{at}ukb.uni-bonn.de).
From the Institute of Human Genetics (Mss Kananura, Gu, and Hallmann,
and Drs Haug, Heils, and Steinlein), and Department of Epileptology (Drs Rebstock
and Heils), University Hospital Bonn, Rheinische Friedrich Wilhelms-University
Bonn, Bonn; Department of Neurology, University Hospital Charité, Humboldt
University of Berlin, Berlin (Dr Sander); and Department of Neurology, University
Hospital Greifswald, Ernst Moritz Arndt-University, Greifswald (Dr Runge),
Germany.
REFERENCES
| |
1. Duncan JS. Idiopathic generalized epilepsies with typical absences. J Neurol. 1997;244:403-411.
FULL TEXT
|
ISI
| PUBMED
2. Schuman SH, Miller LJ. Febrile convulsions in families: findings in an epidemiologic survey. Clin Pediatr (Phila). 1966;5:604-608.
3. Van der Berg BJ, Yerushalmy J. Studies on convulsive disorders in young children, I: incidence of
febrile and nonfebrile convulsions by age and other factors. Pediatr Res. 1969;3:298-304.
4. Nelson KB, Ellenberg JH. Prognosis in children with febrile seizures. Pediatrics. 1978;61:720-727.
FREE FULL TEXT
5. Berkovic SF, Scheffer IE. Febrile seizures: genetics and relationship to other epilepsy syndromes. Curr Opin Neurol. 1998;11:129-134.
FULL TEXT
|
ISI
| PUBMED
6. Italian League Against Epilepsy Genetic Collaborative Group. Concordance of clinical forms of epilepsy in families with several
affected members. Epilepsia. 1993;34:819-826.
FULL TEXT
|
ISI
| PUBMED
7. Scheffer IE, Berkovic SF. Generalized epilepsy with febrile seizures plus: a genetic disorder
with heterogeneous clinical phenotypes. Brain. 1997;120:479-490.
FREE FULL TEXT
8. Singh R, Scheffer IE, Crossland K, Berkovic SF. Generalized epilepsy with febrile seizures plus: a common childhood-onset
genetic epilepsy syndrome. Ann Neurol. 1999;45:75-81.
FULL TEXT
|
ISI
| PUBMED
9. Wallace RH, Wang DW, Singh R, et al. Febrile seizures and generalized epilepsy associated with a mutation
in the Na+-channel beta1 subunit gene SCN1B. Nat Genet. 1998;19:366-370.
FULL TEXT
|
ISI
| PUBMED
10. Escayg A, MacDonald BT, Meisler MH, et al. Mutations of SCN1A, encoding a neuronal sodium channel, in two families
with GEFS+2. Nat Genet. 2000;24:343-345.
FULL TEXT
|
ISI
| PUBMED
11. Sugawara T, Tsurubuchi Y, Agarwala KL, et al. A missense mutation of the Na+ channel alpha II subunit gene Na(v)1.2
in a patient with febrile and afebrile seizures causes channel dysfunction. Proc Natl Acad Sci U S A. 2001;98:6384-6389.
FREE FULL TEXT
12. Baulac S, Huberfeld G, Gourfinkel-An I, et al. First genetic evidence of GABA(A) receptor dysfunction in epilepsy:
a mutation in the gamma2-subunit gene. Nat Genet. 2001;28:46-48.
FULL TEXT
|
ISI
| PUBMED
13. Wallace RH, Marini C, Petrou S, et al. Mutant GABA(A) receptor gamma2-subunit in childhood absence epilepsy
and febrile seizures. Nat Genet. 2001;28:49-52.
FULL TEXT
|
ISI
| PUBMED
14. Olsen RW, Avoli M. GABA and epileptogenesis. Epilepsia. 1997;38:399-407.
FULL TEXT
|
ISI
| PUBMED
15. Snodgrass SR. GABA and epilepsy: their complex relationship and the evolution of
our understanding. J Child Neurol. 1992;7:77-86.
ISI
| PUBMED
16. Gadea A, Lopez-Colome AM. Glial transporters for glutamate, glycine, and GABA, II: GABA transporters. J Neurosci Res. 2001;63:461-468.
FULL TEXT
|
ISI
| PUBMED
17. Commission on Classification and Terminology of the International League
Against Epilepsy proposal for revised classification of epilepsies and epileptic
syndromes. Epilepsia. 1998;30:389-399.
FULL TEXT
18. Miller SA, Dykes D, Plesky HF. A simple salting out procedure for extracting DNA from human nucleated
cells. Nucleic Acids Res. 1988;16:1215.
FREE FULL TEXT
19. SAS/STAT User's Guide, Release 6.03 Edition. Cary, NC: SAS Institute; 1988.
20. Talerico M, Berget SM. Effect of 5' splice site mutations on splicing of the preceding
intron. Mol Cell Biol. 1990;10:6299-6305.
FREE FULL TEXT
21. Nakai K, Sakamoto H. Construction of a novel database containing aberrant splicing mutations
of mammalian genes. Gene. 1994;141:171-177.
FULL TEXT
|
ISI
| PUBMED
22. Anderson SL, Coli R, Daly IW, et al. Familial dysautonomia is caused by mutations of the IKAP gene. Am J Hum Genet. 2001;68:753-758.
FULL TEXT
|
ISI
| PUBMED
23. Whiting P, McKernan RM, Iversen LL. Another mechanism for creating diversity in gamma-aminobutyrate type
A receptors: RNA splicing directs expression of two forms of gamma 2 phosphorylation
site. Proc Natl Acad Sci U S A. 1990;87:9966-9970.
FREE FULL TEXT
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES
|
Intracortical Hyperexcitability in Humans with a GABAA Receptor Mutation
Fedi et al.
Cereb Cortex 2008;18:664-669.
ABSTRACT
| FULL TEXT
GABAA Receptor {gamma}2 Subunit Mutations Linked to Human Epileptic Syndromes Differentially Affect Phasic and Tonic Inhibition
Eugene et al.
J. Neurosci. 2007;27:14108-14116.
ABSTRACT
| FULL TEXT
Reduced cortical inhibition in a mouse model of familial childhood absence epilepsy
Tan et al.
Proc. Natl. Acad. Sci. USA 2007;104:17536-17541.
ABSTRACT
| FULL TEXT
New locus for febrile seizures with absence epilepsy on 3p and a possible modifier gene on 18p
Nabbout et al.
Neurology 2007;68:1374-1381.
ABSTRACT
| FULL TEXT
A {gamma}2(R43Q) Mutation, Linked to Epilepsy in Humans, Alters GABAA Receptor Assembly and Modifies Subunit Composition on the Cell Surface
Frugier et al.
J. Biol. Chem. 2007;282:3819-3828.
ABSTRACT
| FULL TEXT
Nucleus-Specific Abnormalities of GABAergic Synaptic Transmission in a Genetic Model of Absence Seizures
Bessaih et al.
J. Neurophysiol. 2006;96:3074-3081.
ABSTRACT
| FULL TEXT
A GABRB3 promoter haplotype associated with childhood absence epilepsy impairs transcriptional activity
Urak et al.
Hum Mol Genet 2006;15:2533-2541.
ABSTRACT
| FULL TEXT
Ion channels and epilepsy
Graves
QJM 2006;99:201-217.
FULL TEXT
{delta} Subunit Susceptibility Variants E177A and R220H Associated with Complex Epilepsy Alter Channel Gating and Surface Expression of {alpha}4beta2{delta} GABAA Receptors
Feng et al.
J. Neurosci. 2006;26:1499-1506.
ABSTRACT
| FULL TEXT
Sacred disease secrets revealed: the genetics of human epilepsy
Turnbull et al.
Hum Mol Genet 2005;14:2491-2500.
ABSTRACT
| FULL TEXT
Linkage and association of febrile seizures to the IMPA2 gene on human chromosome 18
Nakayama et al.
Neurology 2004;63:1803-1807.
ABSTRACT
| FULL TEXT
A GABAA Receptor Mutation Linked to Human Epilepsy ({gamma}2R43Q) Impairs Cell Surface Expression of {alpha}{beta}{gamma} Receptors
Sancar and Czajkowski
J. Biol. Chem. 2004;279:47034-47039.
ABSTRACT
| FULL TEXT
GABRD encoding a protein for extra- or peri-synaptic GABAA receptors is a susceptibility locus for generalized epilepsies
Dibbens et al.
Hum Mol Genet 2004;13:1315-1319.
ABSTRACT
| FULL TEXT
Genetic influences on myoclonic and absence seizures
Winawer et al.
Neurology 2003;61:1576-1581.
ABSTRACT
| FULL TEXT
Childhood absence epilepsy and febrile seizures: a family with a GABAA receptor mutation
Marini et al.
Brain 2003;126:230-240.
ABSTRACT
| FULL TEXT
|
