 |
 |

Association Between the Extended tau Haplotype and Frontotemporal Dementia
Patrice Verpillat, MD;
Agnès Camuzat, BS;
Didier Hannequin, MD;
Catherine Thomas-Anterion, MD;
Michèle Puel, MD;
Serge Belliard, MD;
Bruno Dubois, MD;
Mira Didic, MD;
Bernard-François Michel, MD;
Lucette Lacomblez, MD;
Olivier Moreaud, MD;
François Sellal, MD;
Véronique Golfier, MD;
Dominique Campion, MD, PhD;
Françoise Clerget-Darpoux, PhD;
Alexis Brice, MD
Arch Neurol. 2002;59:935-939.
ABSTRACT
 |  |
Background Recent studies have shown an association between an extended tau haplotype
(H1) that covers the entire human tau gene and progressive
supranuclear palsy or, more inconsistently, other neurodegenerative disorders,
such as corticobasal degeneration, Parkinson disease, Alzheimer disease, and
frontotemporal dementia (FTD). In addition, disease-causing mutations in the tau gene on chromosome 17 have been detected in some families
with autosomal dominant FTD and parkinsonism. In FTD, the pathological accumulation
of the microtubule-associated protein tau suggests that the tau gene may be a genetic risk factor for this disorder.
Objective To confirm or refute the association between the H1 haplotype or the
H1H1 genotype of the tau gene and FTD.
Design Case-control study.
Setting Neurology departments of 12 French university hospitals.
Participants One hundred unrelated patients with FTD and 79 controls.
Methods Tau genotype (contiguous polymorphisms in exons
1, 7, and 13 and in intron 9 used to reconstruct the extended haplotypes H1
and H2). Clinical examination, psychometric testing, laboratory tests, computed
tomography and magnetic resonance imaging, single-photon emission computed
tomography, and electroencephalography for patients with FTD.
Results The H1H1 genotype was significantly overrepresented
in patients with FTD compared with controls (62% vs 46%;
P = .01, 1-sided; odds ratio adjusted for age and sex, 1.95). After
stratification according to apolipoprotein E (APOE)
genotype, we found a significant interaction between
APOE and tau genotypes
(P = .03).
Conclusions This study of the largest series of patients with FTD confirms the primary
role of tau in FTD and establishes that the H1 haplotype of the tau gene and the E2 allele of APOE interact by an unknown mechanism
that increases the risk of FTD.
INTRODUCTION
FRONTOTEMPORAL dementia (FTD) is a neurodegenerative disorder clinically
characterized by progressive personality change and breakdown in social conduct.1 Since the Lund and Manchester consensus conference,2 the clinical criteria for FTD diagnosis have became
increasingly more precise, facilitating discrimination between FTD and Alzheimer
disease, the most frequent misdiagnosis of FTD.3-4
A major neuropathologic characteristic of FTD is filamentous inclusions containing
hyperphosphorylated tau protein.5 Tau is a
microtubule-associated protein that binds to microtubules and promotes microtubule
assembly. Aggregates of hyperphosphorylated forms of tau protein participate
in the formation of neurofibrillary tangles, which characterize a number of
tauopathic conditions, such as Alzheimer disease, progressive supranuclear
palsy (PSP), corticobasal degeneration (CBD), prion diseases, and amyotrophic
lateral sclerosis/parkinsonism-dementia complex.6
Recently, mutations in the tau gene, localized to
17q21, have been identified in several families with autosomal dominant inheritance
of FTD, designated as FTD with parkinsonism linked to chromosome 17.7-10 To date,
10 missense mutations, 2 deletions, and 3 transition mutations that do not
alter the encoded amino acid sequence have been identified in exons of the tau gene.11-12
In addition, 6 intronic mutations have also been found in the 5' splice
donor site of exon 10.11-12 This
gene accounts for 25% to 40% of families with FTD that have autosomal dominant
inheritance.7, 10, 13
The 6 major isoforms of tau found in the normal adult brain are generated
by alternative splicing of exons 2, 3, and 10.14
These isoforms differ by the presence of 3 or 4 tandem repeats of 31 to 32
amino acids in the carboxy-terminal region, in conjunction with 0, 1, or 2
inserts of 29 amino acids in the amino-terminal region. Sequencing of the tau gene revealed the existence of at least 16 polymorphisms
in different exons and introns.15 All of these
polymorphisms are in complete linkage disequilibrium with each other.16 As a result, there are only 2 common extended haplotypes,
H1 and H2, that cover the entire tau gene (approximately
100 kilobases). Analysis of these 2 haplotypes revealed no recombinant event
in more than 500 chromosomes.16-18
Association studies have been performed on polymorphisms of the tau gene and in disorders in which the tau protein is variably
involved in the physiopathology. The A0 allele of a dinucleotide polymorphism
in intron 9 of the tau gene (included in the H1 haplotype)
was first found to be associated with PSP.19
This association was replicated in different populations20-25
and extended to the entire H1 haplotype.16, 26-27
The haplotype has also been found to be associated with CBD,17, 24, 28
Parkinson disease,23-24,29
and Alzheimer disease,30-31 but
with inconsistent results.23-24,29, 32-34
Morris et al24 found no significant difference
in the frequency of the A0 allele and the A0A0 genotype in 32 patients with
FTD and in 75 control subjects. However, in 36 clinically ascertained patients
with FTD, Ingelson et al15 recently found that
the H1 haplotype, in combination with the apolipoprotein E (APOE) 4 allele, was a genetic risk factor for FTD.
The present study was initiated to determine whether an association
between the H1 haplotype and FTD could be detected in a larger independent
population of clinically ascertained patients with FTD and a different genetic
background (French population) than in previous studies.
PARTICIPANTS AND METHODS
PARTICIPANTS
After excluding all patients with autosomal dominant inheritance and
mutation of tau (n = 6),10 our sample was composed
of 100 unrelated patients with FTD (44% men) admitted consecutively to 12
hospitals in France in a 3-year period. All patients with FTD underwent a
thorough clinical examination, including personal and familial medical history,
neurologic and psychiatric investigations, psychometric testing (Mini-Mental
State Examination,35 Mattis Dementia Rating
Scale,36 Verbal Learning Test,37
and Frontal Assessment Battery38), laboratory
tests, computed tomography and magnetic resonance imaging, regional cerebral
blood flow measurement (single-photon emission computed tomography), and electroencephalography.
The diagnosis of FTD was established according to the Lund-Manchester clinical
consensus criteria for FTD,2 revised in 1998.39 Age at onset was assessed by interviewing 1 or 2
next of kin and was defined as the age at which relevant symptoms first appeared
according to the family (mean ± SD age at onset, 60.6 ± 9.3
years; range, 35-77 years). We identified 40 patients with at least 1 first-
or second-degree relative with FTD but without autosomal dominant inheritance
and mutation in the tau gene (30% of men; mean ±
SD age at onset, 58.7 ± 9.0 years; range, 35-77 years).
Postmortem neuropathologic examination was performed in 3 patients.
Blocks of frontal, temporal, parietal, and occipital cortex; amygdala; hippocampus;
basal ganglia; thalamus; and cerebellum were stained with usual stains (hematoxylin-eosin
and Bodian silver method associated with luxol fast blue). By gross examination,
the frontal lobe was moderately to severely atrophic. All 3 patients showed
degeneration of the cerebral cortex, which was severe in the frontal cortex,
less severe in the temporal and parietal cortices, and generally absent in
the occipital cortex. Degeneration was characterized by microvacuolation,
considerable neuronal loss, and astrocytic gliosis, especially in layers I
and II of the frontotemporal cortices and in the CA1 and subiculum regions.
Swollen neurons, Pick bodies, Lewy bodies, neurofibrillary tangles, and senile
plaques were absent. Therefore, frontal lobe atrophy lacking distinctive histologic
characteristics or features was defined for each patient subjected to autopsy.40
Patients with FTD were compared with 79 age-matched controls (30% men;
mean ± SD age at examination, 60.0 ± 8.8 years; range, 38-77
years). Control subjects were the patients' spouses, healthy blood donors,
or individuals living in nursing homes. All participants in this study were
white and were living in France. Informed written consent was obtained from
all participants, either directly or from the legal tutor.
GENOTYPING AND HAPLOTYPE RECONSTRUCTION
Polymorphisms of exons 1 (+5 A/G), 7 (528 G/A), and 13 (+34 T/C) were
analyzed by polymerase chain reaction amplification, followed by digestion
of the product with the diagnostic restriction enzyme. For polymorphism of
exon 7, a 5' mismatch primer was designed to create an artificial site
that could be used for genotyping (reverse: 5' AGCTGGGTGGTGTCTTTGGAGCGGA
3'). Exons were amplified from genomic DNA from individuals with labeled
primers corresponding to flanking intronic sequences.41
Two hundred nanograms of genomic DNA were used in a 25-µL reaction mixture
containing 0.5µM each primer, 0.2mM desoxy trinucleotide triphosphate
(dNTP), 1.5mM magnesium chloride, 1X buffer, and 1 U Taq (Invitrogen, Paisley,
Scotland). Amplification of exon 7 required the addition of 10% dimethylsulfoxid.
Amplifications were performed in thermal cycles (Perkin Elmer 9600; Perkin
Elmer, Boston, Mass). Initial denaturation took place at 96°C for 10 minutes,
35 cycles at 96°C for 30 seconds, 55°C or 62°C for 30 seconds,
and 72°C for 45 seconds, with a final extension at 72°C for 10 minutes.
Polymerase chain reaction products were digested with 2-U AluI for exon 1,
FokI for exon 7, and Tsp509I for exon 13 in a final volume of 40 µL.
For exons 1 and 7, digestion was carried out at 37°C overnight, and for
exon 13 at 65°C for 3 hours. All samples were also genotyped by polymerase
chain reaction with a labeled forward primer for the intronic dinucleotide
repeated polymorphism. Two hundred nanograms of genomic DNA were used in a
25-µL reaction mixture containing 0.5µM each primer, 0.2mM dNTP,
1.5mM magnesium chloride, 1X buffer, and 1 U of Taq
(Invitrogen). Conditions consisted of initial denaturation at 96°C for
10 minutes followed by 35 cycles at 96°C for 30 seconds, 62°C for
30 seconds, and 72°C for 45 seconds, with a final extension at 72°C
for 10 minutes. Results were analyzed on an ABI377 automated sequencer using
Genescan and Genotyper software (Perkin Elmer). Haplotypes were reconstructed
as previously described.16
STATISTICAL ANALYSES
Power computations were made using nQuery Advisor Release 4.0 (Statistical
Solutions, Saugus, Mass). Statistical analyses were performed using SAS software
release 8.0 (SAS Institute Inc, Cary, NC). Because all previous studies with
positive results found a significant increase in the H1 haplotype or H1H1 genotype frequency, our objective was to confirm or
refute the hypothesis that the H1 haplotype or H1H1
genotype is overrepresented in patients with FTD compared with controls. The
frequencies of this haplotype and of H1H1 homozygotes were therefore compared
with the sum of the other haplotypic and genotypic frequencies, a strategy
that allowed us to analyze the data using 1-tailed tests, providing the most
powerful statistical analysis for testing this previous hypothesis. Therefore,
for initial comparisons, the 2 test or, when appropriate,
the Fisher exact test was used to determine potential differences between
the distributions of the H1 haplotype or the H1H1
genotype in each group. Odds ratios (ORs) and their 95% confidence intervals
(95% CIs) were adjusted for age and sex. Analysis of variance was used to
compare the mean age at onset and the mean age at examination in the 2 groups.
We used multiple logistic regression analysis to take into account possible
confounding factors such as age, sex, and APOE status and to test the interaction
between the tau and APOE
genes.
RESULTS
Assuming a 1-sided significance level of = .05 and a power (1 - ß)
of 80%, the size of our sample (100 patients with FTD and 79 controls) was
sufficient to detect an OR of at least 2.10 for carriers of the H1H1 genotype and of at least 1.85 for carriers of the H1 haplotype.
Haplotype and genotype frequencies are presented in Table 1. No deviation from Hardy-Weinberg equilibrium was observed
in the control group, for which the allele and genotype frequencies were similar
to those reported in other European white populations.17, 21, 28
The distribution of the H1H1 genotype in patients
with FTD and controls was significantly different (OR [H1H1 vs other genotypes], 1.95; 95% CI, 1.18-3.22; P = .01) and borderline significant for the H1 haplotype frequency
(OR, 1.46; 95% CI, 0.98-2.17; P = .057). The mean
age at onset of symptoms was similar in the H1H1 group (60.5 ± 9.2
years) and in patients with other genotypes (61.5 ± 9.5 years) (P = .46). After stratification on the absence (FH-)
or presence (FH+) of a familial history of FTD, the results were even more
significant in the FH- group (H1H1 vs others: FH- group OR, 2.26;
95% CI, 1.25-4.11; P = .01; FH+ group OR, 1.46; 95%
CI, 0.69-3.06; P = .16).
|
|
|
|
Table 1. Haplotype and Genotype Frequencies in 100 Patients With FTD
and 79 Controls*
|
|
|
Because the H1 haplotype increased the risk of FTD in combination with
APOE4,15 we next stratified our sample according
to the presence or absence of an APOE4 allele in
the genotype. No interaction was found in our sample, and no OR was significant
(data not shown). However, because 2 previous independent studies41-42 suggested that the APOE2 allele is a risk factor for FTD and not APOE4, we then stratified our sample according to the presence or absence
of an APOE2 allele in the genotype (Table 2). Multivariate logistic regression showed that the interaction
between APOE and tau genotypes
was significant (ßinteraction = -1.89; P = .03). Odds ratios calculated to take into account this interaction
are presented in Table 3. The
results remained significant, or borderline significant, even after Bonferroni
correction for multiple tests.
|
|
|
|
Table 2. Combined Analysis of tau Genotypes
and APOE2 Alleles in 100 Patients With FTD and 79
Controls*
|
|
|
|
|
|
|
Table 3. Odds Ratios (ORs), 95% Confidence Intervals (CIs), and P Values When Combining APOE and tau Genotypes*
|
|
|
COMMENT
The results of this case-control study, to our knowledge the largest
performed to date in FTD, suggest that patients who are H1H1 homozygotes for
the tau gene are at increased risk for developing
FTD. The different results observed between patients with FH+ and those with
FH- are probably owing to the difference in the sample size (40 patients
with FH+ and 60 with FH-), and thus in the study power.
Previous studies have reported an association between this haplotype
in the tau gene and PSP16, 27
and CBD,17, 28 which are also characterized
by neuronal accumulation of tau protein. It must be added that earlier studies19-24
of an association with the most common allele of the dinucleotide polymorphism
(A0) in intron 9 of the tau gene reflect in fact
the association with the broader haplotype. The A0 allele for this polymorphism
is indeed included in the H1 haplotype.16 Two
previous studies15, 24 have analyzed
this haplotype in patients with FTD, but the results were not significant.
Because of the small size of the samples (36 and 32 patients with FTD, respectively),
these studies probably did not have sufficient a priori statistical power
to demonstrate a nonmajor effect of the H1 haplotype. Our study of 100 patients
with FTD was sufficiently powerful to detect an effect (OR) of at least 2.10
for the H1H1 genotype and 1.85 for the H1 haplotype.
A possible confounding factor in our study could be "contamination"
by patients with PSP or CBD. Therefore, we decided to use strict criteria
for the diagnosis of FTD: (1) clinical diagnosis according to the Lund-Manchester
clinical consensus criteria for FTD,2, 39
(2) neuropsychologic confirmation of frontal lobe dysfunction, (3) frontal
or frontotemporal atrophy on computed tomographic or magnetic resonance images,
and (4) frontotemporal hypoperfusion on single-photon emission computed tomographic
images. Furthermore, we used age-matched controls, and ORs were adjusted for
age and sex to eliminate these possible confounding factors. So, although
only a small proportion of the patients were examined neuropathologically
(3%), which allowed confirmation of the diagnosis of FTD, misdiagnosis as
PSP or CBD is unlikely given the criteria used to assess patients.
The recent findings of pathogenic mutations in the tau gene in 25% to 40% of patients with FTD and autosomal dominant
inheritance7, 10, 13
and the association of an extended haplotype that covers the entire tau gene indicate that tau plays a primary role in FTD
and also in other neurodegenerative disorders with altered tau profiles, such
as PSP, CBD, and Parkinson disease. Although our findings clearly suggest
that the tau gene is a genetic risk factor for FTD, the molecular mechanisms
underlying this effect are not known yet. It is possible to speculate, however,
that the H1 haplotype is associated with a different level of tau gene expression than the H2 haplotype. However, the biologically
relevant polymorphisms that are responsible for the risk of the disease remain
to be determined.
The interaction between the tau and APOE genes was significant. The logistic regression coefficient for
the interaction term was negative, which explains why the estimated OR for
carriers of both at-risk genotypes (carriers of the H1H1 tau genotype and of 1 APOE2 alleles) was lower than the OR estimated for only one of the
at-risk genotypes. Therefore, the effects of these 2 risk factors do not seem
to be synergistic but rather alternative: each at-risk genotype has an effect
when individuals are carriers of one of them, but this effect disappears when
individuals are carriers of both. The interaction found in our study (with
APOE2) is different from that found by Ingelson et al15
(with APOE4). Divergent results have also been observed among studies of APOE
in FTD. Indeed, several studies have suggested that APOE might be a risk factor
in FTD, but APOE2 was associated with FTD in 2 studies42-43
and APOE4 in 2 other studies.42, 44
The size of the case-control sample reported in the article by Ingelson et
al15 (n = 36) could be another possible point
of difference to explain why their results are different from ours. However,
the molecular mechanisms for the interaction between tau and APOE in the pathway
to tau physiopathology seen in FTD are still unknown and should be specified
by molecular studies.
The fact that the H1 haplotype in the tau gene seems to be a risk factor
for several neurodegenerative disorders with different clinical presentations,
including FTD, suggests that these disorders share a common pathogenic mechanism
that involves tau dysfunction. Further studies are needed to determine how
the H1 haplotype in the tau gene affects the neurodegenerative
processes to better understand the pathogenesis of such disorders.
AUTHOR INFORMATION
Accepted for publication February 4, 2002.
Author contributions: Study concept and design (Drs Verpillat, Hannequin, Thomas-Anterion, Dubois, Michel, Campion,
Clerget-Darpoux, and Brice); acquisition of data (Drs Verpillat, Hannequin, Thomas-Anterion, Puel, Belliard, Dubois, Didic,
Michel, Lacomblez, Moreaud, Sellal, Golfier, Campion, and Brice and Ms Camuzat); analysis and interpretation of data (Drs Verpillat,
Dubois, Campion, Clerget-Darpoux, and Brice); drafting of the manuscript (Drs Verpillat and Hannequin); critical revision of the
manuscript for important intellectual content (Drs Hannequin,
Thomas-Anterion, Puel, Belliard, Dubois, Didic, Michel, Lacomblez, Moreaud,
Sellal, Golfier, Campion, Clerget-Darpoux, and Brice and Ms Camuzat);
statistical expertise (Dr Verpillat); obtained funding (Drs Verpillat, Michel, Lacomblez, and Brice); administrative,
technical, and material support (Drs Verpillat, Hannequin,
Thomas-Anterion, Michel, Sellal, Campion, and Brice and Ms Camuzat);
study supervision (Drs Verpillat, Hannequin, Dubois, Michel,
Lacomblez, Campion, Clerget-Darpoux, and Brice).
This work was supported by a grant from the Fondation pour la Recherche
Médicale and from INSERM, Paris.
We thank Merle Ruberg, PhD, for her critical readings of the manuscript.
Corresponding author: Patrice Verpillat, MD, Département d'Epidémiologie,
de Biostatistique, et de Recherche Clinique, Hôpital Bichat-Claude Bernard,
46 rue Henri Huchard, 75877 Paris CEDEX 18, France (e-mail: patrice.verpillat{at}bch.ap-hop-paris.fr).
From Institut National de la Santé et de la Recherche Médicale
(INSERM) U535, Le Kremlin Bicêtre (Drs Verpillat and Clerget-Darpoux);
the Department of Epidemiology and Biostatistics, University Hospital Bichat-Claude
Bernard, Assistance PubliqueHôpitaux de Paris (AP-HP)/University
Paris VII, Paris (Dr Verpillat); INSERM U289, University Hospital Salpêtrière,
Paris (Drs Verpillat and Brice and Ms Camuzat); INSERM Equipe Propre Inserm
(EPI) 9906, Rouen (Drs Hannequin and Campion); the Department of Neurology,
University Hospital, Rouen (Dr Hannequin); the Department of Neurology, University
Hospital, Saint-Etienne (Dr Thomas-Anterion); the Department of Neurology,
University Hospital Purpan, Toulouse (Dr Puel); the Department of Neurology,
University Hospital Pontchaillou, Rennes (Drs Belliard and Golfier); the Department
of Neurology, University Hospital Salpêtrière, Paris (Dr Dubois);
the Department of Neurology and Neuropsychology, University Hospital Timone,
Marseille (Dr Didic); INSERM Equipe Mixte Inserm (EMI) U9926, Marseille (Dr
Didic); the Department of Neurology, University Hospital Sainte-Marguerite,
Marseille (Dr Michel); the Federation of Neurology Mazarin and the Department
of Pharmacology (Dr Lacomblez) and the Department of Genetics, Cytogenetics
and Embryology (Dr Brice), University Hospital Salpêtrière, Paris;
the Department of Neurology, University Hospital, Grenoble (Dr Moreaud); and
the Department of Neurology, University Hospital, Strasbourg (Dr Sellal),
France.
REFERENCES
 |  |
1. Neary D. Dementia of frontal lobe type. J Am Geriatr Soc. 1990;38:71-72.
ISI
| PUBMED
2. The Lund and Manchester Groups. Clinical and neuropathological criteria for frontotemporal dementia. J Neurol Neurosurg Psychiatry. 1994;57:416-418.
FREE FULL TEXT
3. Gearing M, Mirra SS, Hedreen JC, et al. The Consortium to Establish a Registry for Alzheimer's Disease (CERAD),
part X: neuropathology confirmation of the clinical diagnosis of Alzheimer's
disease. Neurology. 1995;45:461-466.
FREE FULL TEXT
4. Mendez MF, Selwood A, Mastri AR, Frey WH. Pick's disease versus Alzheimer's disease: a comparison of clinical
characteristics. Neurology. 1993;43:289-292.
FREE FULL TEXT
5. Spillantini MG, Van Swieten JC, Goedert M. Tau gene mutations in frontotemporal dementia and parkinsonism linked
to chromosome 17 (FTDP-17). Neurogenetics. 2000;2:193-205.
ISI
| PUBMED
6. Fabre SF, Forsell C, Viitanen M, et al. Clinic-based cases with frontotemporal dementia show increased cerebrospinal
fluid tau and high apolipoprotein E 4 frequency, but no tau gene mutations. Exp Neurol. 2001;168:413-418.
FULL TEXT
|
ISI
| PUBMED
7. Hutton M, Lendon CL, Rizzu P, et al. Association of missense and 5'-splice-site mutations in tau with
the inherited dementia FTDP-17. Nature. 1998;393:702-705.
FULL TEXT
| PUBMED
8. Spillantini MG, Murrell JR, Goedert M, et al. Mutation in the tau gene in familial multiple system tauopathy with
presenile dementia. Proc Natl Acad Sci U S A. 1998;95:7737-7741.
FREE FULL TEXT
9. Poorkaj P, Bird TD, Wijsman E, et al. Tau is a candidate gene for chromosome 17 frontotemporal dementia. Ann Neurol. 1998;43:815-825.
FULL TEXT
|
ISI
| PUBMED
10. Dumanchin C, Camuzat A, Campion D, et al. Segregation of a missense mutation in the microtubule-associated protein
tau gene with familial frontotemporal dementia and parkinsonism. Hum Mol Genet. 1998;7:1825-1829.
FREE FULL TEXT
11. Reed LA, Wszolek ZK, Hutton M. Phenotypic correlations in FTDP-17. Neurobiol Aging. 2001;22:89-107.
FULL TEXT
|
ISI
| PUBMED
12. Miyamoto K, Kowalska A, Hasegawa M, et al. Familial frontotemporal dementia and parkinsonism with a novel mutation
at an intron 10 + 11-splice site in the tau gene. Ann Neurol. 2001;50:117-120.
FULL TEXT
|
ISI
| PUBMED
13. Rizzu P, Van Swieten JC, Joosse M, et al. High prevalence of mutations in the microtubule-associated protein
tau in a population study of frontotemporal dementia in the Netherlands. Am J Hum Genet. 1999;64:414-421.
FULL TEXT
|
ISI
| PUBMED
14. Goedert M, Spillantini MG, Jakes R, Rutherford D, Crowther RA. Multiple isoforms of human microtubule-associated protein tau: sequences
and localization in neurofibrillary tangles of Alzheimer's disease. Neuron. 1989;3:519-526.
FULL TEXT
|
ISI
| PUBMED
15. Ingelson M, Fabre SF, Lilius L, et al. Increased risk for frontotemporal dementia through interaction between
tau polymorphisms and apolipoprotein E 4. Neuroreport. 2001;12:905-909.
FULL TEXT
|
ISI
| PUBMED
16. Baker M, Litvan I, Houlden H, et al. Association of an extended haplotype in the tau gene with progressive
supranuclear palsy. Hum Mol Genet. 1999;8:711-715.
FREE FULL TEXT
17. Houlden H, Baker M, Morris HR, et al. Corticobasal degeneration and progressive supranuclear palsy share
a common tau haplotype. Neurology. 2001;56:1702-1706.
FREE FULL TEXT
18. Russ C, Lovestone S, Baker M, et al. The extended haplotype of the microtubule associated protein tau gene
is not associated with Pick's disease. Neurosci Lett. 2001;299:156-158.
FULL TEXT
|
ISI
| PUBMED
19. Conrad C, Andreadis A, Trojanowski JQ, et al. Genetic evidence for the involvement of tau in progressive supranuclear
palsy. Ann Neurol. 1997;41:277-281.
FULL TEXT
|
ISI
| PUBMED
20. Higgins JJ, Litvan I, Pho LT, Li W, Nee LE. Progressive supranuclear gaze palsy is in linkage disequilibrium with
the tau and not the alpha-synuclein gene. Neurology. 1998;50:270-273.
FREE FULL TEXT
21. Bennett P, Bonifati V, Bonuccelli U, et al for the European Study Group on Atypical Parkinsonism Consortium. Direct genetic evidence for involvement of tau in progressive supranuclear
palsy. Neurology. 1998;51:982-985.
FREE FULL TEXT
22. Oliva R, Tolosa E, Ezquerra M, et al. Significant changes in the tau A0 and A3 alleles in progressive supranuclear
palsy and improved genotyping by silver detection. Arch Neurol. 1998;55:1122-1124.
FREE FULL TEXT
23. Hoenicka J, Perez M, Perez-Tur J, et al. The tau gene A0 allele and progressive supranuclear palsy. Neurology. 1999;53:1219-1225.
FREE FULL TEXT
24. Morris HR, Janssen JC, Bandmann O, et al. The tau gene A0 polymorphism in progressive supranuclear palsy and
related neurodegenerative diseases. J Neurol Neurosurg Psychiatry. 1999;66:665-667.
FREE FULL TEXT
25. Molinuevo JL, Valldeoriola F, Alegret M, Oliva R, Tolosa E. Progressive supranuclear palsy: earlier age of onset in patients with
the tau protein A0/A0 genotype. J Neurol. 2000;247:206-208.
FULL TEXT
|
ISI
| PUBMED
26. Higgins JJ, Adler RL, Loveless JM. Mutational analysis of the tau gene in progressive supranuclear palsy. Neurology. 1999;53:1421-1424.
FREE FULL TEXT
27. Higgins JJ, Golbe LI, De Biase A, et al. An extended 5'-tau susceptibility haplotype in progressive supranuclear
palsy. Neurology. 2000;55:1364-1367.
FREE FULL TEXT
28. Di Maria E, Tabaton M, Vigo T, et al. Corticobasal degeneration shares a common genetic background with progressive
supranuclear palsy. Ann Neurol. 2000;47:374-377.
FULL TEXT
|
ISI
| PUBMED
29. Pastor P, Ezquerra M, Munoz E, et al. Significant association between the tau gene A0/A0 genotype and Parkinson's
disease. Ann Neurol. 2000;47:242-245.
FULL TEXT
|
ISI
| PUBMED
30. Lilius L, Froelich Fabre S, Basun H, et al. Tau gene polymorphisms and apolipoprotein E 4 may interact to
increase risk for Alzheimer's disease. Neurosci Lett. 1999;277:29-32.
FULL TEXT
|
ISI
| PUBMED
31. Bullido MJ, Aldudo J, Frank A, et al. A polymorphism in the tau gene associated with risk for Alzheimer's
disease. Neurosci Lett. 2000;278:49-52.
FULL TEXT
|
ISI
| PUBMED
32. Ezquerra M, Pastor P, Valldeoriola F, et al. Identification of a novel polymorphism in the promoter region of the
tau gene highly associated to progressive supranuclear palsy in humans. Neurosci Lett. 1999;275:183-186.
FULL TEXT
|
ISI
| PUBMED
33. Crawford F, Freeman M, Town T, et al. No genetic association between polymorphisms in the tau gene and Alzheimer's
disease in clinic or population based samples. Neurosci Lett. 1999;266:193-196.
FULL TEXT
|
ISI
| PUBMED
34. Baker M, Graff-Radford D, Wavrant DeVrieze F, et al. No association between TAU haplotype and Alzheimer's disease in population
or clinic based series or in familial disease. Neurosci Lett. 2000;285:147-149.
FULL TEXT
|
ISI
| PUBMED
35. Folstein MF, Folstein SE, McHugh PR. "Mini-mental state": a practical method for grading the cognitive state
of patients for the clinician. J Psychiatr Res. 1975;12:189-198.
FULL TEXT
|
ISI
| PUBMED
36. Mattis S. Dementia Rating Scale. Odessa, Fla: Psychological Assessment Resources Inc; 1988.
37. Grober E, Buschke H. Genuine memory deficits in dementia. Dev Neuropsychol. 1987;3:13-36.
38. Dubois B, Slachevsky A, Litvan I, Pillon B. The FAB: a Frontal Assessment Battery at bedside. Neurology. 2000;55:1621-1626.
FREE FULL TEXT
39. Neary D, Snowden JS, Gustafson L, et al. Frontotemporal lobar degeneration: a consensus on clinical diagnostic
criteria. Neurology. 1998;51:1546-1554.
FREE FULL TEXT
40. Hauw JJ, Duyckaerts C, Seilhean D, et al. The neuropathologic diagnostic criteria of frontal lobe dementia revisited:
a study of ten consecutive cases. J Neural Transm Suppl. 1996;47:47-59.
PUBMED
41. Froelich S, Basun H, Forsell C, et al. Mapping of a disease locus for familial rapidly progressive frontotemporal
dementia to chromosome 17q12-21. Am J Med Genet. 1997;74:380-385.
FULL TEXT
|
ISI
| PUBMED
42. Gustafson L, Abrahamson M, Grubb A, Nilsson K, Fex G. Apolipoprotein-E genotyping in Alzheimer's disease and frontotemporal
dementia. Dement Geriatr Cogn Disord. 1997;8:240-243.
FULL TEXT
|
ISI
| PUBMED
43. Lehmann DJ, Smith AD, Combrinck M, Barnetson L, Joachim C. Apolipoprotein E 2 may be a risk factor for sporadic frontotemporal
dementia [letter]. J Neurol Neurosurg Psychiatry. 2000;69:404-405.
FREE FULL TEXT
44. Stevens M, van Duijn CM, de Knijff P, et al. Apolipoprotein E gene and sporadic frontal lobe dementia. Neurology. 1997;48:1526-1529.
FREE FULL TEXT
CiteULike Connotea Del.icio.us Digg Reddit Technorati Twitter
What's this?
RELATED ARTICLE
Archives of Neurology Reader's Choice: Continuing Medical Education
Arch Neurol. 2002;59(6):1048-1050.
FULL TEXT
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES
 |
Association of the Tau Haplotype H2 With Age at Onset and Functional Alterations of Glucose Utilization in Frontotemporal Dementia
Laws et al.
Am. J. Psychiatry 2007;164:1577-1584.
ABSTRACT
| FULL TEXT
Association Between Tau H2 Haplotype and Age at Onset in Frontotemporal Dementia
Borroni et al.
Arch Neurol 2005;62:1419-1422.
ABSTRACT
| FULL TEXT
Genetic aspects of Alzheimer's disease, Pick's disease, and other dementias
Nee et al.
AM J ALZHEIMERS DIS OTHER DEMEN 2004;19:219-225.
ABSTRACT
Association of polymorphisms in the Tau and Saitohin genes with Parkinson's disease
Levecque et al.
J. Neurol. Neurosurg. Psychiatry 2004;75:478-480.
ABSTRACT
| FULL TEXT
Medical and environmental risk factors for sporadic frontotemporal dementia: a retrospective case-control study
Rosso et al.
J. Neurol. Neurosurg. Psychiatry 2003;74:1574-1576.
ABSTRACT
| FULL TEXT
|