You are seeing this message because your Web browser does not support basic Web standards. Find out more about why this message is appearing and what you can do to make your experience on this site better.


ABOUT ARCHIVES
Advanced Search

Welcome   | My Account | E-mail Alerts | Access Rights | Sign In


  Vol. 59 No. 6, June 2002 TABLE OF CONTENTS
  Archives
  •  Online Features
  Observation
 This Article
 •Abstract
 •PDF
 • Reply to article
 •Send to a friend
 • Save in My Folder
 •Save to citation manager
 •Permissions
 Citing Articles
 •Citing articles on ISI (9)
 •Contact me when this article is cited
 Related Content
 •Related article
 •Similar articles in this journal
 Topic Collections
 •Neurogenetics
 •Genetic Disorders
 •Alert me on articles by topic
 Social Bookmarking
  Add to CiteULike Add to Connotea Add to Del.icio.us Add to Digg Add to Reddit Add to Technorati
What's this?

Complex Neurologic Syndrome Associated With the G1606A Mutation of Mitochondrial DNA

Sabrina Sacconi, MD; Leonardo Salviati, MD; Clifton Gooch, MD; Eduardo Bonilla, MD; Sara Shanske, PhD; Salvatore DiMauro, MD

Arch Neurol. 2002;59:1013-1015.

ABSTRACT

Objectives  To confirm the pathogenicity of the G-to-A substitution at nucleotide 1606 (G1606A) mutation in the mitochondrial DNA (mtDNA) tRNAVal gene, and to characterize genotype-phenotype correlation.

Patient and Methods  A 37-year-old man since childhood developed a complex clinical picture characterized by hearing loss, migraine, ataxia, seizures, cataracts, retinitis pigmentosa, mental deterioration, and hypothyroidism. Magnetic resonance imaging revealed diffuse calcification of the basal ganglia and cerebral cortical atrophy. Morphologic and biochemical studies of respiratory chain complexes were performed in skeletal muscle. All 22 mitochondrial tRNA genes were screened for mutations by direct sequencing.

Results  Biochemical analysis showed normal activities of respiratory chain enzymes and citrate synthase; morphologic examination showed scattered ragged-red fibers and poor or absent cytochrome c oxidase staining in 10% of the fibers. A heteroplasmic G1606A transition in the mtDNA tRNAVal gene was found. Mutant DNA was 70% of the total in the proband's muscle. The mutation was absent in blood samples and urinary sediment from his healthy brother and mother.

Conclusion  This second patient with the G1606A mutation confirms both the pathogenicity of the mutation and its association with a characteristic complex neurologic phenotype.



INTRODUCTION
 Jump to Section
 •Top
 •Introduction
 •Report of a case
 •Methods
 •Results
 •Comment
 •Conclusions
 •Author information
 •References

IN THE PAST 14 years, more than 100 point mutations in transfer RNA (tRNA) genes of human mitochondrial DNA (mtDNA) have been reported, in association with a wide spectrum of clinical features. Although brain and skeletal muscle are most frequently involved, patients may present with a variety of neurologic and nonneurologic features. Some mutations tend to be associated with specific clinical syndromes, but exceptions and "overlap syndromes" abound. This complexity of genotype-phenotype correlation relates mostly to the abundance of mutant mtDNA and its tissue distribution, but also to mtDNA haplotype, mtDNA copy number, and nuclear background.1 In addition, the high frequency of mtDNA polymorphisms makes it difficult to distinguish neutral changes from pathogenic mutations, especially in nonprotein coding genes. By consensus, the pathogenic role of a given mtDNA change cannot be considered conclusively documented until the mutation is identified in different families. We describe a second patient with a complex multisystemic syndrome associated with a G-to-A substitution at nucleotide 1606 (G1606A) mutation in the tRNAVal gene.2 This finding confirms the pathogenic role of the mutation and contributes to define a characteristic genotype-phenotype correlation.


REPORT OF A CASE
 Jump to Section
 •Top
 •Introduction
 •Report of a case
 •Methods
 •Results
 •Comment
 •Conclusions
 •Author information
 •References

A 37-year-old man reported that since the age of 10 years he has had progressive hearing loss and left-sided migrainous headache. At the age of 20 years, he underwent bilateral extracapsular cataract extractions, and, since the age of 32 years, he developed progressive dementia, loss of balance, and retinitis pigmentosa. He also had recurrent episodes of loss of consciousness and developed myoclonic jerks in all limbs, more prominently on the left side.

At the age of 35 years, he was diagnosed as having hypothyroidism and his condition was successfully treated with hormone supplementation. His 76-year-old mother and his only sibling, a brother aged 43 years, are in good health.

Physical examination showed slight dysmetria and mild difficulty with tandem gait. Eye movements were fully preserved and muscle bulk and strength were normal. Examination of cognitive functions, which were clearly impaired, was made difficult by the severe hearing loss and behavioral abnormalities.

Laboratory findings included normal levels for serum creatine kinase, and serum lactate, and pyruvate. The patient refused a spinal tap. The electrocardiogram was normal.

Nerve conduction studies and electromyography demonstrated mild bilateral ulnar neuropathy at the elbow and borderline values of short-duration motor unit potentials in the proximal limb muscles, consistent with early myopathy. Brain magnetic resonance imaging revealed diffuse calcification of the basal ganglia and cerebral cortical atrophy.


METHODS
 Jump to Section
 •Top
 •Introduction
 •Report of a case
 •Methods
 •Results
 •Comment
 •Conclusions
 •Author information
 •References

Histochemical analysis of a muscle biopsy specimen and measurements of respiratory chain enzyme activities were performed as described.3-4 All 22 mitochondrial tRNA genes were amplified using suitable oligonucleotide primers. The resulting polymerase chain reaction (PCR) fragments were subjected to direct sequencing with the ABI Prism Dye Terminator Cycle Sequencing Ready Reaction Kit and 310 Automatic Sequencer (Applied Biosystem; Perkin Elmer, Foster City, Calif).

For restriction fragment length polymorphism analysis mtDNA from the proband, his mother, and brother was amplified using the following primers: CTACGCATTTATATAGAGGAGAC (nt1534->1554 [where nt indicates nucleotide]) and a mismatched backward primer TGGGTGCTTTGTGTTAAGCTGC (nt1629->1608, 1609 A->G) designed to create a BsmI site in the mutant allele. Polymerase chain reaction conditions were 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds. After 35 cycles, 4 µCi of {alpha}32P-dCTP [where 32P indicates deoxycytosine triphosphorus labeled with phosphorus 32] (3000 Ci/mmol) were added and a last PCR cycle was performed. Aliquots (10 µL) of PCR products were digested with the appropriate restriction endonuclease and electrophoresed in 20% nondenaturing acrylamide gel. The proportion of mutant mtDNA was evaluated in a phosphor-imager (Molecular Analyst; BioRad, Hercules, Calif) using Image-Quant software (Molecular Dynamics, Sunnyvale, Calif).


RESULTS
 Jump to Section
 •Top
 •Introduction
 •Report of a case
 •Methods
 •Results
 •Comment
 •Conclusions
 •Author information
 •References

HISTOCHEMICAL AND BIOCHEMICAL STUDIES

Histological and histochemical analysis of a needle biopsy specimen from the left vastus lateralis muscle showed sparse ragged-red fibers. Histochemistry for cytochrome c oxidase showed that 10% of the fibers stained poorly or not at all. No clear excess of sarcoplasmic lipid was noted by oil-red O staining. These findings were consistent with a primary mitochondrial disease. Biochemical analysis showed normal activities of respiratory chain enzymes and citrate synthase.

GENETIC STUDIES

Sequencing of the 22 tRNA genes of mtDNA revealed a heteroplasmic G-to-A transition in the tRNAVal gene at nucleotide position 1606 of the reference sequence5 (Figure 1A). The mutation was heteroplasmic in muscle (70% mutant). It was absent in blood samples and urinary sediment of the proband's mother and brother (Figure 1B). No other tissue from the proband was available.



View larger version (75K):
[in this window]
[in a new window]
Figure 1. A, Sequence of the complementary strand of the mitochondrial DNA tRNAVal gene showing the C-to-T transition at nucleotide 1606. B, Polymerase chain reaction–restriction fragment length polymorphism analysis of the mutation. Amplified fragments of 96 base pairs (bp) are spliced into 70-bp and 26-bp fragments after digestion with BsmI when harboring the mutation. Lanes: 1, patient muscle; 2, brother's blood sample; 3, brother's urinary sediment; 4, mother's blood sample; 5, mother's urinary sediment; 6, normal muscle control; 7, uncut fragment; and M, 100-bp marker.



COMMENT
 Jump to Section
 •Top
 •Introduction
 •Report of a case
 •Methods
 •Results
 •Comment
 •Conclusions
 •Author information
 •References

The G-to-A transition at nucleotide 1606 of the tRNAVal gene was previously described in a patient, who was seen at the age of 20 years with bilateral hearing loss and who at the age of 40 years developed bilateral cataracts, cognitive impairment, ataxia, mild weakness, seizures, and myoclonus.2 Our patient had a similar phenotype: in both patients the initial symptom was hearing loss, followed by ocular, brain, and muscle involvement. However, our patient had earlier onset and additional symptoms, including migraine, hypothyroidism, and retinitis pigmentosa. While retinitis pigmentosa and migraine are common in mitochondrial encephalomyopathies, hypothyroidism has been reported only in association with large-scale rearrangements of mtDNA6 and with the A-to-G substitution at nucleotide 3243 (MELAS) mutation.7 Although both patients had similar mutational loads in muscle, our patient had only electrophysiologic and pathologic evidence of myopathy without overt weakness.

Whereas the G1606A mutation was maternally inherited in the patient described by Tiranti et al,2 it seemed sporadic in our patient, although we cannot exclude that his mother and brother had mutational levels below the threshold of detection in blood and urinary tract cells.

In both patients, the mutation did not impair respiratory chain enzyme activities in skeletal muscle, where mutant levels around 70% are probably just above the pathologic threshold. Assuming a uniform distribution of the mutation in all tissues, a functional defect may become evident only in tissues with a very high energy requirement, eg, auditory receptors, retina, and brain. As both patients were alive when studied no data exist on the percentage of heteroplasmy in these tissues.

It has been observed that mutations at the same position in the cloverleaf structure of different tRNA genes are associated to similar clinical phenotypes.8 For example, mutations at nt-4285 in the tRNAIle and at nt-5703 in the tRNAAsn, both at the position 27 of the tRNA structure, are associated with progressive external ophthalmoplegia (for other examples see Figure 2).



View larger version (50K):
[in this window]
[in a new window]
Figure 2. The generic transfer RNA cloverleaf with standard nucleotide numbering.9 Five sets of pathogenic mutations are boxed. Mutations at the same position (regardless of the specific tRNA in which the mutation is located) are associated with 0 similar phenotypes (modified from Schon et al8).


The G1606A mutation disrupts a G-C pair in the acceptor stem of the tRNA Val at the same position on the tRNA structure as reported on T7512C mutation in the tRNASer(UCN) gene.10-11 In 3 patients with the T7512C mutation, the clinical phenotype was similar to that causing the G1606A mutation and consisted of hearing loss, ataxia, cognitive impairment, seizures, and myoclonus. Although these patients had more severe symptoms, these may be related to higher percentages of mutant mtDNA (>90% in muscle). These findings add further credence to the hypothesis that the genotype-phenotype relationship of mtDNA tRNA mutations may be related not only to alterations of the DNA sequence, but to disruptions of the secondary and tertiary structures.8 Our study confirms the pathogenic role of the G1606A mutation of the tRNAVal gene and the association between this genotype and a complex syndrome characterized by ataxia, hearing loss, seizures, cataracts, and mental deterioration.


CONCLUSIONS
 Jump to Section
 •Top
 •Introduction
 •Report of a case
 •Methods
 •Results
 •Comment
 •Conclusions
 •Author information
 •References

Patients presenting with these clinical features, with or without maternal inheritance, should be investigated for the presence of either the G1606A tRNAVal mutation or the T7512C tRNASer(UCN) mutation. Identifying more patients will help to define both the frequency of these mutations and the consistency of their clinical expression.


AUTHOR INFORMATION
 Jump to Section
 •Top
 •Introduction
 •Report of a case
 •Methods
 •Results
 •Comment
 •Conclusions
 •Author information
 •References

Accepted for publication November 13, 2001.

Author contributions: Study concept and design (Drs Sacconi, Salviati, Shanske, and DiMauro); acquisition of data (Drs Sacconi, Salviati, Gooch, Bonilla, and Shanske); analysis and interpretation of data (Drs Sacconi, Salviati, Gooch, Bonilla, and DiMauro); drafting of the manuscript (Drs Sacconi and Salviati); critical revision of the manuscript for important intellectual content (Dr Sacconi, Gooch, Bonilla, Shanske, and DiMauro); administrative, technical, and material support (Dr Gooch); study supervision (Dr DiMauro); patient evaluation and electrophysiologic testing (Dr Gooch).

This study was supported by grants PO1HD32062 and NS11766 (Dr DiMauro) from the National Institutes of Health, Bethesda, Md, and by a grant from the Muscular Dystrophy Association, Tucson, Ariz. Dr Salviati is supported by grant 439b from Telethon Italia, Rome.

Reprints: Salvatore DiMauro, MD, College of Physicians and Surgeons, 630 W 168th St, Room 4-420, New York, NY 10032 (e-mail: sd12{at}columbia.edu).

From the Departments of Neurology (Drs Sacconi, Salviati, Gooch, Bonilla, Shanske, and DiMauro) and Pathology (Dr Bonilla), Columbia University, New York, NY; Department of Neurology, University of Modena, Modena, Italy (Dr Sacconi); and the Department of Pediatrics, University of Padova, Padova, Italy (Dr Salviati).


REFERENCES
 Jump to Section
 •Top
 •Introduction
 •Report of a case
 •Methods
 •Results
 •Comment
 •Conclusions
 •Author information
 •References

1. Pulkes T, Hanna MG. Human mitochondrial DNA diseases. Adv Drug Deliv Rev. 2001;49:27-43. FULL TEXT | ISI | PUBMED
2. Tiranti V, D'Agruma L, Pareyson D, et al. A novel mutation in the mitochondrial tRNA(Val) gene associated with a complex neurological presentation. Ann Neurol. 1998;43:98-101. FULL TEXT | ISI | PUBMED
3. Sciacco M, Bonilla E. Cytochemistry and immunocytochemistry of mitochondria in tissue sections. Methods Enzymol. 1996;264:509-521. PUBMED
4. DiMauro S, Servidei S, Zeviani M, et al. Cytochrome c oxidase deficiency in Leigh syndrome. Ann Neurol. 1987;22:498-506. FULL TEXT | ISI | PUBMED
5. Anderson S, Bankier AT, Barrell BG, et al. Sequence and organization of the human mitochondrial genome. Nature. 1981;290:457-465. FULL TEXT | PUBMED
6. De Joanna G, Santorelli FM, Casali C, Brescia-Morra V, Perretti A, Santoro L. Combination of mtDNA mutations in a patient with a mitochondrial multisystem syndrome. J Hum Genet. 2000;45:109-111. FULL TEXT | ISI | PUBMED
7. Balestri P, Grosso S. Endocrine disorders in two sisters affected by MELAS syndrome. J Child Neurol. 2000;15:755-758. FREE FULL TEXT
8. Schon EA, Bonilla E, DiMauro S. Mitochondrial DNA mutations and pathogenesis. J Bioenerg Biomembr. 1997;29:131-149. FULL TEXT | ISI | PUBMED
9. Sprinzl M, Hartmann T, Weber J, Blank J, Zeidler R. Compilation of tRNA sequences and sequences of tRNA genes. Nucleic Acids Res. 1989;17(suppl):1-172.
10. Nakamura M, Nakano S, Goto Y, et al. A novel point mutation in the mitochondrial tRNASer(UCN) gene detected in a family with MERRF/MELAS overlap syndrome. Biochem Biophys Res Commun. 1995;214:86-93. FULL TEXT | ISI | PUBMED
11. Jaksch M, Klopstock T, Kurlemann G, et al. Progressive myoclonus epilepsy and mitochondrial myopathy associated with mutations in the tRNASer(UCN) gene. Ann Neurol. 1998;44:635-640. FULL TEXT | ISI | PUBMED


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati     What's this?

RELATED ARTICLE

Archives of Neurology Reader's Choice: Continuing Medical Education
Arch Neurol. 2002;59(6):1048-1050.
FULL TEXT  






HOME | CURRENT ISSUE | PAST ISSUES | TOPIC COLLECTIONS | CME | SUBMIT | SUBSCRIBE | HELP
CONDITIONS OF USE | PRIVACY POLICY | CONTACT US | SITE MAP
 
© 2002 American Medical Association. All Rights Reserved.