 |
 |

Complex Neurologic Syndrome Associated With the G1606A Mutation of Mitochondrial DNA
Sabrina Sacconi, MD;
Leonardo Salviati, MD;
Clifton Gooch, MD;
Eduardo Bonilla, MD;
Sara Shanske, PhD;
Salvatore DiMauro, MD
Arch Neurol. 2002;59:1013-1015.
ABSTRACT
 |  |
Objectives To confirm the pathogenicity of the G-to-A substitution at nucleotide
1606 (G1606A) mutation in the mitochondrial DNA (mtDNA) tRNAVal gene, and to characterize genotype-phenotype correlation.
Patient and Methods A 37-year-old man since childhood developed a complex clinical picture
characterized by hearing loss, migraine, ataxia, seizures, cataracts, retinitis
pigmentosa, mental deterioration, and hypothyroidism. Magnetic resonance imaging
revealed diffuse calcification of the basal ganglia and cerebral cortical
atrophy. Morphologic and biochemical studies of respiratory chain complexes
were performed in skeletal muscle. All 22 mitochondrial tRNA genes were screened for mutations by direct sequencing.
Results Biochemical analysis showed normal activities of respiratory chain enzymes
and citrate synthase; morphologic examination showed scattered ragged-red
fibers and poor or absent cytochrome c oxidase staining
in 10% of the fibers. A heteroplasmic G1606A transition in the mtDNA tRNAVal gene was found. Mutant DNA was 70% of
the total in the proband's muscle. The mutation was absent in blood samples
and urinary sediment from his healthy brother and mother.
Conclusion This second patient with the G1606A mutation confirms both the pathogenicity
of the mutation and its association with a characteristic complex neurologic
phenotype.
INTRODUCTION
IN THE PAST 14 years, more than 100 point mutations in transfer RNA
(tRNA) genes of human mitochondrial DNA (mtDNA) have
been reported, in association with a wide spectrum of clinical features. Although
brain and skeletal muscle are most frequently involved, patients may present
with a variety of neurologic and nonneurologic features. Some mutations tend
to be associated with specific clinical syndromes, but exceptions and "overlap
syndromes" abound. This complexity of genotype-phenotype correlation relates
mostly to the abundance of mutant mtDNA and its tissue distribution, but also
to mtDNA haplotype, mtDNA copy number, and nuclear background.1
In addition, the high frequency of mtDNA polymorphisms makes it difficult
to distinguish neutral changes from pathogenic mutations, especially in nonprotein
coding genes. By consensus, the pathogenic role of a given mtDNA change cannot
be considered conclusively documented until the mutation is identified in
different families. We describe a second patient with a complex multisystemic
syndrome associated with a G-to-A substitution at nucleotide 1606 (G1606A)
mutation in the tRNAVal gene.2 This finding confirms the pathogenic role of the mutation
and contributes to define a characteristic genotype-phenotype correlation.
REPORT OF A CASE
A 37-year-old man reported that since the age of 10 years he has had
progressive hearing loss and left-sided migrainous headache. At the age of
20 years, he underwent bilateral extracapsular cataract extractions, and,
since the age of 32 years, he developed progressive dementia, loss of balance,
and retinitis pigmentosa. He also had recurrent episodes of loss of consciousness
and developed myoclonic jerks in all limbs, more prominently on the left side.
At the age of 35 years, he was diagnosed as having hypothyroidism and
his condition was successfully treated with hormone supplementation. His 76-year-old
mother and his only sibling, a brother aged 43 years, are in good health.
Physical examination showed slight dysmetria and mild difficulty with
tandem gait. Eye movements were fully preserved and muscle bulk and strength
were normal. Examination of cognitive functions, which were clearly impaired,
was made difficult by the severe hearing loss and behavioral abnormalities.
Laboratory findings included normal levels for serum creatine kinase,
and serum lactate, and pyruvate. The patient refused a spinal tap. The electrocardiogram
was normal.
Nerve conduction studies and electromyography demonstrated mild bilateral
ulnar neuropathy at the elbow and borderline values of short-duration motor
unit potentials in the proximal limb muscles, consistent with early myopathy.
Brain magnetic resonance imaging revealed diffuse calcification of the basal
ganglia and cerebral cortical atrophy.
METHODS
Histochemical analysis of a muscle biopsy specimen and measurements
of respiratory chain enzyme activities were performed as described.3-4 All 22 mitochondrial tRNA genes were amplified using suitable oligonucleotide primers. The
resulting polymerase chain reaction (PCR) fragments were subjected to direct
sequencing with the ABI Prism Dye Terminator Cycle Sequencing Ready Reaction
Kit and 310 Automatic Sequencer (Applied Biosystem; Perkin Elmer, Foster City,
Calif).
For restriction fragment length polymorphism analysis mtDNA from the
proband, his mother, and brother was amplified using the following primers:
CTACGCATTTATATAGAGGAGAC (nt1534 1554 [where nt indicates nucleotide])
and a mismatched backward primer TGGGTGCTTTGTGTTAAGCTGC (nt1629 1608,
1609 A G) designed to create a BsmI site in
the mutant allele. Polymerase chain reaction conditions were 94°C for
30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds. After 35
cycles, 4 µCi of 32P-dCTP [where 32P indicates
deoxycytosine triphosphorus labeled with phosphorus 32] (3000 Ci/mmol) were
added and a last PCR cycle was performed. Aliquots (10 µL) of PCR products
were digested with the appropriate restriction endonuclease and electrophoresed
in 20% nondenaturing acrylamide gel. The proportion of mutant mtDNA was evaluated
in a phosphor-imager (Molecular Analyst; BioRad, Hercules, Calif) using Image-Quant
software (Molecular Dynamics, Sunnyvale, Calif).
RESULTS
HISTOCHEMICAL AND BIOCHEMICAL STUDIES
Histological and histochemical analysis of a needle biopsy specimen
from the left vastus lateralis muscle showed sparse ragged-red fibers. Histochemistry
for cytochrome c oxidase showed that 10% of the fibers
stained poorly or not at all. No clear excess of sarcoplasmic lipid was noted
by oil-red O staining. These findings were consistent with a primary mitochondrial
disease. Biochemical analysis showed normal activities of respiratory chain
enzymes and citrate synthase.
GENETIC STUDIES
Sequencing of the 22 tRNA genes of mtDNA revealed
a heteroplasmic G-to-A transition in the tRNAVal
gene at nucleotide position 1606 of the reference sequence5
(Figure 1A). The mutation was heteroplasmic
in muscle (70% mutant). It was absent in blood samples and urinary sediment
of the proband's mother and brother (Figure
1B). No other tissue from the proband was available.
|
|
|
|
Figure 1. A, Sequence of the complementary
strand of the mitochondrial DNA tRNAVal
gene showing the C-to-T transition at nucleotide 1606. B, Polymerase chain
reactionrestriction fragment length polymorphism analysis of the mutation.
Amplified fragments of 96 base pairs (bp) are spliced into 70-bp and 26-bp
fragments after digestion with BsmI when harboring
the mutation. Lanes: 1, patient muscle; 2, brother's blood sample; 3, brother's
urinary sediment; 4, mother's blood sample; 5, mother's urinary sediment;
6, normal muscle control; 7, uncut fragment; and M, 100-bp marker.
|
|
|
COMMENT
The G-to-A transition at nucleotide 1606 of the tRNAVal gene was previously described in a patient, who was seen
at the age of 20 years with bilateral hearing loss and who at the age of 40
years developed bilateral cataracts, cognitive impairment, ataxia, mild weakness,
seizures, and myoclonus.2 Our patient had a
similar phenotype: in both patients the initial symptom was hearing loss,
followed by ocular, brain, and muscle involvement. However, our patient had
earlier onset and additional symptoms, including migraine, hypothyroidism,
and retinitis pigmentosa. While retinitis pigmentosa and migraine are common
in mitochondrial encephalomyopathies, hypothyroidism has been reported only
in association with large-scale rearrangements of mtDNA6
and with the A-to-G substitution at nucleotide 3243 (MELAS) mutation.7 Although both patients had similar mutational loads
in muscle, our patient had only electrophysiologic and pathologic evidence
of myopathy without overt weakness.
Whereas the G1606A mutation was maternally inherited in the patient
described by Tiranti et al,2 it seemed sporadic
in our patient, although we cannot exclude that his mother and brother had
mutational levels below the threshold of detection in blood and urinary tract
cells.
In both patients, the mutation did not impair respiratory chain enzyme
activities in skeletal muscle, where mutant levels around 70% are probably
just above the pathologic threshold. Assuming a uniform distribution of the
mutation in all tissues, a functional defect may become evident only in tissues
with a very high energy requirement, eg, auditory receptors, retina, and brain.
As both patients were alive when studied no data exist on the percentage of
heteroplasmy in these tissues.
It has been observed that mutations at the same position in the cloverleaf
structure of different tRNA genes are associated
to similar clinical phenotypes.8 For example,
mutations at nt-4285 in the tRNAIle and
at nt-5703 in the tRNAAsn, both at the
position 27 of the tRNA structure, are associated with progressive external
ophthalmoplegia (for other examples see Figure
2).
|
|
|
|
Figure 2. The generic transfer RNA cloverleaf
with standard nucleotide numbering.9 Five sets
of pathogenic mutations are boxed. Mutations at the same position (regardless
of the specific tRNA in which the mutation is located)
are associated with 0 similar phenotypes (modified from Schon et al8).
|
|
|
The G1606A mutation disrupts a G-C pair in the acceptor stem of the
tRNA Val at the same position on the tRNA structure as reported
on T7512C mutation in the tRNASer(UCN)
gene.10-11 In 3 patients with
the T7512C mutation, the clinical phenotype was similar to that causing the
G1606A mutation and consisted of hearing loss, ataxia, cognitive impairment,
seizures, and myoclonus. Although these patients had more severe symptoms,
these may be related to higher percentages of mutant mtDNA (>90% in muscle).
These findings add further credence to the hypothesis that the genotype-phenotype
relationship of mtDNA tRNA mutations may be related not only to alterations
of the DNA sequence, but to disruptions of the secondary and tertiary structures.8 Our study confirms the pathogenic role of the G1606A
mutation of the tRNAVal gene and the association
between this genotype and a complex syndrome characterized by ataxia, hearing
loss, seizures, cataracts, and mental deterioration.
CONCLUSIONS
Patients presenting with these clinical features, with or without maternal
inheritance, should be investigated for the presence of either the G1606A
tRNAVal mutation or the T7512C tRNASer(UCN) mutation.
Identifying more patients will help to define both the frequency of these
mutations and the consistency of their clinical expression.
AUTHOR INFORMATION
Accepted for publication November 13, 2001.
Author contributions: Study concept and design (Drs Sacconi, Salviati, Shanske, and DiMauro); acquisition
of data (Drs Sacconi, Salviati, Gooch, Bonilla, and Shanske); analysis and interpretation of data (Drs Sacconi,
Salviati, Gooch, Bonilla, and DiMauro); drafting of the manuscript (Drs Sacconi and Salviati); critical revision of the manuscript
for important intellectual content (Dr Sacconi, Gooch, Bonilla,
Shanske, and DiMauro); administrative, technical, and material support (Dr Gooch); study supervision (Dr DiMauro); patient evaluation and electrophysiologic testing (Dr Gooch).
This study was supported by grants PO1HD32062 and NS11766 (Dr DiMauro)
from the National Institutes of Health, Bethesda, Md, and by a grant from
the Muscular Dystrophy Association, Tucson, Ariz. Dr Salviati is supported
by grant 439b from Telethon Italia, Rome.
Reprints: Salvatore DiMauro, MD, College of Physicians and Surgeons,
630 W 168th St, Room 4-420, New York, NY 10032 (e-mail: sd12{at}columbia.edu).
From the Departments of Neurology (Drs Sacconi, Salviati, Gooch, Bonilla,
Shanske, and DiMauro) and Pathology (Dr Bonilla), Columbia University, New
York, NY; Department of Neurology, University of Modena, Modena, Italy (Dr
Sacconi); and the Department of Pediatrics, University of Padova, Padova,
Italy (Dr Salviati).
REFERENCES
 |  |
1. Pulkes T, Hanna MG. Human mitochondrial DNA diseases. Adv Drug Deliv Rev. 2001;49:27-43.
FULL TEXT
|
ISI
| PUBMED
2. Tiranti V, D'Agruma L, Pareyson D, et al. A novel mutation in the mitochondrial tRNA(Val) gene associated with a complex neurological presentation. Ann Neurol. 1998;43:98-101.
FULL TEXT
|
ISI
| PUBMED
3. Sciacco M, Bonilla E. Cytochemistry and immunocytochemistry of mitochondria in tissue sections. Methods Enzymol. 1996;264:509-521.
PUBMED
4. DiMauro S, Servidei S, Zeviani M, et al. Cytochrome c oxidase deficiency in Leigh syndrome. Ann Neurol. 1987;22:498-506.
FULL TEXT
|
ISI
| PUBMED
5. Anderson S, Bankier AT, Barrell BG, et al. Sequence and organization of the human mitochondrial genome. Nature. 1981;290:457-465.
FULL TEXT
| PUBMED
6. De Joanna G, Santorelli FM, Casali C, Brescia-Morra V, Perretti A, Santoro L. Combination of mtDNA mutations in a patient with a mitochondrial multisystem
syndrome. J Hum Genet. 2000;45:109-111.
FULL TEXT
|
ISI
| PUBMED
7. Balestri P, Grosso S. Endocrine disorders in two sisters affected by MELAS syndrome. J Child Neurol. 2000;15:755-758.
FREE FULL TEXT
8. Schon EA, Bonilla E, DiMauro S. Mitochondrial DNA mutations and pathogenesis. J Bioenerg Biomembr. 1997;29:131-149.
FULL TEXT
|
ISI
| PUBMED
9. Sprinzl M, Hartmann T, Weber J, Blank J, Zeidler R. Compilation of tRNA sequences and sequences of tRNA genes. Nucleic Acids Res. 1989;17(suppl):1-172.
10. Nakamura M, Nakano S, Goto Y, et al. A novel point mutation in the mitochondrial tRNASer(UCN) gene detected in a family with MERRF/MELAS overlap syndrome. Biochem Biophys Res Commun. 1995;214:86-93.
FULL TEXT
|
ISI
| PUBMED
11. Jaksch M, Klopstock T, Kurlemann G, et al. Progressive myoclonus epilepsy and mitochondrial myopathy associated
with mutations in the tRNASer(UCN) gene. Ann Neurol. 1998;44:635-640.
FULL TEXT
|
ISI
| PUBMED
CiteULike Connotea Del.icio.us Digg Reddit Technorati Twitter
What's this?
RELATED ARTICLE
Archives of Neurology Reader's Choice: Continuing Medical Education
Arch Neurol. 2002;59(6):1048-1050.
FULL TEXT
|