 |
 |

Clinical and Molecular Studies in a Family With Probable X-linked Dominant Charcot-Marie-Tooth Disease Involving the Central Nervous System
Fuki M. Hisama, MD;
Helen H. Lee, BS;
Amy Vashlishan;
Poornima Tekumalla, PhD;
David S. Russell, MD, PhD;
Elizabeth Auld, PA;
Jonathan M. Goldstein, MD
Arch Neurol. 2001;58:1891-1896.
ABSTRACT
 |  |
Objective To investigate the clinical and molecular
characteristics of an apparently X-linked dominant form of
Charcot-Marie-Tooth (CMT) disease in a family with central nervous
system involvement and additional features.
Background Charcot-Marie-Tooth disease may be inherited as an
autosomal dominant, autosomal recessive, or X-linked trait. In the
X-linked dominant form of CMT, females demonstrate milder clinical and
electrophysiological features compared with their male relatives.
Methods Clinical and related examinations were performed in 4
affected individuals from a family with a novel form of CMT affecting
males more severely than females. DNA analysis of the connexin 32
(Cx32) gene and proteolipid protein (PLP) gene was
performed. We genotyped 3 members of the family to determine which
regions of the X chromosome were inherited discordantly in the affected
and unaffected brothers.
Results Clinical studies revealed significant
spasticity, hyperreflexia, and delayed central conduction, in addition
to peripheral neuropathy. Nerve conduction velocities were slower in
the affected males than in the affected females. Direct DNA sequencing
of the Cx32 coding region and neural-specific promoter were
normal. A PLP null mutation was excluded. Levels of very long
chain fatty acids were normal. Genotyping studies of the X chromosome
supported X-linked inheritance of the neuropathy.
Conclusions This family differs from others with hereditary
motor and sensory neuropathic diseases by the presence of upper motor
neuron signs and additional features. The clinical features and
inheritance pattern are consistent with X-linked dominant inheritance
or autosomal dominant inheritance.
INTRODUCTION
CHARCOT-Marie-Tooth (CMT) disease is a clinically and genetically heterogeneous group of
peripheral nerve disorders characterized by distal weakness, atrophy,
sensory loss, and decreased tendon reflexes.1, 2
Charcot-Marie-Tooth has been classified according to the pattern of
inheritance and whether the abnormalities affect primarily myelin
(CMT1) or axons (CMT2). Median motor nerve conduction
velocities distinguish the 2 types.3 Genetic studies have
identified mutations in several peripheral myelin genes: peripheral
myelin protein 22 (PMP22), myelin protein zero (P0),
and early growth response 2 (EGR2).4 The
X-linked dominant form of CMT (CMTX) was mapped to Xq13.1, and
subsequently, mutations in connexin 32 (Cx32) were shown to
cosegregate with the phenotype.5 In CMTX families, males
generally have a more severe phenotype than females, with onset of
symptoms at an earlier age. Nerve conduction velocities are typically
slower in affected males compared with their affected female
relatives.6 More than 160 mutations in the Cx32
gene have been reported in CMTX families.7
We describe here the clinical and genetic studies in a family
with an apparently novel form of X-linked dominant CMT with
spasticity and central conduction delay.
PATIENTS AND METHODS
PATIENTS
Clinical information and family history were obtained by inpatient or
outpatient evaluations in the Neurology Department at Yale
New Haven Hospital, New Haven, Conn, or the West Haven Veteran's
Hospital, West Haven, Conn. Clinical records from Newington Children's
Hospital, Newington, Conn, for patient IV-1 were reviewed. Additional
family history was obtained through interviews with family members, one
of whom is a nurse. Written informed consent was obtained from
participants according to a protocol approved by the Human
Investigations Committee at Yale. Genomic DNA was extracted from
peripheral blood lymphocytes using standard methods. Patient III-1
twice declined to have blood drawn from herself or her son.
ELECTROPHYSIOLOGICAL EVALUATION
All nerve conduction studies were performed by one of us (J.M.G.)
using Dantech (Counterpoint MK2 or Neuromatic 2000; Medtronic
Functional Diagnostics, Shoreview, Minn) equipment. Standard
techniques were applied to measure nerve conduction. Visual evoked
potentials were obtained by pattern reversal to monocular full-field
stimulation using 30-minute checks, reversing at a rate of 1.9 Hz.
Brainstem auditory evoked potentials were performed using monaural
stimulation with rarefaction clicks with a 100-ms duration at a rate of
11.1 Hz. Somatosensory evoked potentials were elicited by unilateral
percutaneous stimulation of the median nerve at a threshold just above
motor threshold, and recorded from the brachial plexus (Erb potential),
cervical spine at C2 (N13), and the contralateral parietal area (N19)
with a frontal (Fz) reference.
ANALYSIS OF Cx32
The Cx32 gene coding region (exon 2) was amplified by
polymerase chain reaction (PCR) using previously published primer
sets.8 The reaction mixture (25 µL) contained 100 ng of
genomic DNA, 10mM Tris-HCl (pH, 8.3), 60mM KCl, 7 pmol of each primer,
1.25mM MgCl2, 2.5 U of AmpliTaq DNA polymerase (Applied
Biosystems, Foster City, Calif). After an initial
denaturation step at 95°C for 5 minutes, PCR was performed for 35
cycles at 95°C for 1 minute, 60°C for 1 minute, and 72°C for 1
minute, followed by a final extension step of 72°C for 5 minutes. The
PCR products were analyzed on a 1% agarose gel, purified by Qiaquick
columns (Qiagen, Valencia, Calif) and directly sequenced using an
automated 373A sequencer (Applied Biosystems). Sequence
comparisons were done manually and with BLAST software (National
Center for Biotechnology Information, Bethesda, Md).
ANALYSIS OF THE Cx32 PROMOTER REGION
The Cx32 gene promoter P2 region was amplified using
primers P7 and P11 and conditions previously reported9 in a
50-µL reaction containing 100 ng of genomic DNA. The size
of the product was verified by electrophoresis on a 2% agarose gel,
and sequenced using an Applied Biosystems 373A sequencer. In addition,
a new primer, P9, was designed (antisense, -397 to -417), 5'
CACCCAGACAGGTCCCCTATG 3', and used with the published primer
P16 (antisense, -745 to -725) to amplify a 348base pair (bp)
product for restriction digestion.9 Restriction digests
were performed at 37°C with 10 µL of the PCR product and 20 U of
BanII (New England Biolabs, Beverly, Mass) for 2 hours.
ANALYSIS OF THE PROTEOLIPID PROTEIN GENE
We excluded the G-4 deletion described by Garbern et al10
and other mutations in exon 1 of the proteolipid protein (PLP)
gene by using the PCR-directed site-specific mutagenesis test developed
by Sistermans et al.11 Briefly, a mutated forward primer
was used with an intron 1specific reverse primer to introduce a
NcoI site into the resulting 114-bp PCR fragment. Restriction
digestion with NcoI from a wild-type allele results in 85-bp
and 29-bp fragments; an exon 1 mutation will prevent this digestion.
GENOTYPING
X-chromosomal microsatellite markers were tested by use of primers
available from Research Genetics (Huntington, Ala). Details
regarding primer sequences and PCR conditions are available from the
Genome Database (http://gdbwww.gdb.org). Locations and
genetic distances were obtained from a Marshfield chromosome map
(http://research.marshfieldclinic.org/genetics/), the Integrated
X-Chomosome Database, version 2.3 (http://ixdb.molgen.mpg.de/), and the
Cooperative Human Linkage Center
(http://cgap.nci.nih.gov/CHLC). Polymerase chain reaction
amplifications were performed in a 25-µL reaction containing 10 to
100 ng of genomic DNA, 10mM Tris-HCl (pH, 8.3), 50mM KCl, 2.5mM
MgCl2, 7 pmol each of sense and antisense primer, 250 µM
of dNTPS, and 0.25 U of Taq polymerase
(Perkin-Elmer). Ten to 25 ng of PCR product was diluted to 6
µL with denaturing solution (94% formamide, 0.05% xylene cyanol
solution, and 0.04% bromophenol blue), and heat denatured at 95°C
for 5 minutes. Samples were separated at 5°C or 20°C on 12.5%
polyacrylamide gels (GeneGel Excel 12.5/24; Amersham Pharmacia Biotech
AB, Uppsala, Sweden) from the manufacturer using the GenePhor
Electrophoresis Unit (Amersham Pharmacia Biotech). Following
the separation, the DNA was stained using the Hoefer Automated Gel
Stainer with the PlusOne DNA SilverStaining Kit (Amersham Pharmacia
Biotech).
RESULTS
CLINICAL FINDINGS
Patient II-7
The proband (patient II-7,
Figure 1), a 56-year-old woman, was born
with a foot deformity and was a clumsy child. She developed gait
instability at age 20 years. At age 18 years, she completed boot camp
and subsequently served 2 years in the
military. She slowly developed progressive weakness
and sensory loss in the distal extremities and a wide-based gait. By
her late 30s she used a cane; a decade later she used a walker; and in
her early 50s, she began using a wheelchair for long distances. The
ethnic background of the family is English and French on the paternal
side and Pennsylvania Dutch on the maternal side. A recent neurologic
examination showed dysarthric speech, spasticity in the legs, distal
atrophy in the arms and legs, hyperreflexia in the arms, ankle
areflexia, a left Babinski sign, and pes cavus. The following test
results were normal: creatine kinase, aldolase, rheumatoid factor,
antinuclear antibody, C-reactive protein, folate,
and vitamin B12 levels; brain computed tomography scan;
myelogram; and phytanic acid level. Results of commercial DNA testing
(Athena Diagnostics, Worcester, Mass) for spinocerebellar ataxia 1
(SCA1), SCA2, SCA3, Friedreich ataxia, the peripheral myelin protein 22
(PMP22) duplication, and Cx32 mutations were normal.
Cerebrospinal fluid protein level was elevated on 2 occasions (89 mg/dL
and 69 mg/dL [normal range, 15-45 mg/dL]). A magnetic
resonance imaging (MRI) scan of the brain and spine at age 47 years
showed bilateral increased signal in the white matter, with a normal
corpus callosum, mild atrophy of the distal thoracic cord, and conus
medullaris. Evoked potentials were performed at age 42 years. Visual
evoked potential showed normal response on the right side, and small
amplitude and delayed potentials on the left side. There was a history
of childhood amblyopia. Somatosensory evoked potentials showed grossly
delayed, small-amplitude spinal and cerebral potentials. Brain stem
auditory evoked potentials showed normal eighth-nerve volleys, but
central potentials were delayed and of reduced amplitude. In summary,
these suggested both central and peripheral conduction delay. Nerve
conduction studies for the 4 affected individuals are summarized in
Table 1. Results were consistent
with demyelinating and axonal sensorimotor neuropathy. Significantly,
nerve conduction velocities were slower in the males than the females,
and were near normal in an obligate gene carrier female (patient
III-1).
|
|
|
|
The family pedigree. Patient II-7 is the proband, indicated by an
arrow. Clinical and electrophysiological examinations were performed on
patients II-7, III-1, III-4 and IV-1. Genotyping was performed on
patients II-7, III-4 and III-5.
|
|
|
|
|
|
|
Table 1. Clinical Features and Peripheral Nerve Conduction Studies*
|
|
|
Patient III-4
The proband's son is a 33-year-old man who was born after a
complicated forceps delivery with face presentation and had a childhood
learning disability. He had bronchitis as an infant, talked at age 3
years, and walked at age 9 years with long leg braces. His clinical
features included mental retardation, a total of 3 seizures, nystagmus,
severe kyphoscoliosis, hip dislocation, and contractures of the hips,
knees, and wrists by his late 20s. His examination was remarkable for
limited and dysarthric speech, nystagmus, peripheral neuropathy, distal
atrophy, pes cavus, spasticity, increased patellar reflexes, absent
ankle reflexes, and plantar responses. He is confined to bed and
stretcher because of the scoliosis and contractures, is fed by a
gastrostomy tube, and lives in a group home. He had the following
normal test results: SCA1 and SCA3; very long chain fatty acid
(VLCFA) and lactate levels; and hexosaminidase A and B,
arylsulfatase A, galactocerebrosidase, and ß-mannosidase activities.
Urine sulfatide level was mildly elevated in one test. Results of a
retinal examination were normal. Audiometry results were normal.
Patient III-1
The proband's daughter is a 36-year-old woman with a normal early
history. She walked at 14 months. She began to have episodes of
twisting her ankles and occasional falls as a teenager. On examination
at age 23 years, she had pes cavus, distal leg atrophy, normal muscle
strength including peroneals, claw toes, and mild spasticity of the
legs. Levels of VLCFA were normal. At age 27 years, visual and
brainstem auditory evoked potentials were done. The P100 latencies were
normal (left, 98 ms; right, 89 ms) but with an interocular latency
difference of 9 ms (+2 SD). Brainstem auditory evoked
potential showed a prolonged wave III-V interpeak interval of 2.44 ms
and a wave I-V interpeak interval of 4.60 ms following right ear
stimulation. This suggests a conduction defect between the lower pons
and the midbrain and abnormal latency intensity function of wave V
bilaterally, suggesting possible associated conductive hearing loss.
Formal audiometry was not performed.
Patient IV-1
The 12-year-old (current age) grandson of the proband has motor and
sensory neuropathy, bilateral hip dysplasia, and spasticity. He had
peripheral neuropathy as well as spasticity by age 4 years. He
underwent eye surgery for strabismus and had multiple leg operations,
including adductor tenotomies, lengthening of the Achilles tendons, and
femoral osteotomies. He walks with leg braces and a walker. He uses a
wheelchair for long distances. He is in special education for reading
and math, and takes regular classes for other subjects. Test results
included normal lactate and pyruvate levels in blood and CSF, and
normal ammonia and VLCFA levels. Cerebral spinal fluid protein
level was elevated at 54 mg/dL (normal range, 15-45 mg/dL).
Brainstem auditory evoked potential was abnormal with no wave V
recorded on the right and a reproducible wave V on the left. The left
wave I-III interpeak latency was 2.76 ms, the left wave I-V interpeak
latency was 4.54 ms, and the right wave I-III interpeak latency was
3.10 ms, which was consistent with conduction delay between the eighth
nerve and lower pons.
MOLECULAR STUDIES OF Cx32 AND THE PLP GENES
Direct DNA sequencing of the coding region (exon 2) of Cx32 in
patient II-7 by both commercial and research testing, and of patient
III-4 by research testing did not detect any mutations. By sequencing
the neural-specific promoter region (exon 1b) in these 2 individuals,
we identified 4 sequence variants (Table
2) compared with the published sequence
(Genbank L47127). An A-to-C transversion at -544 bp from the
ATG start site resulted in a new BanII restriction
fragment-length polymorphism. All 4 sequence variants were confirmed by
sequencing or restriction digestion of the product of separate PCR
reactions. Each variant was found in 16 of 16 healthy controls, with no
evidence of CMT or spasticity on neurologic examination. The
PCR-directed site-specific mutagenesis test did not detect mutations in
the small (4 nucleotides) coding region of exon 1 of the PLP
gene in patients II-7, III-4, and III-5.
|
|
|
|
Table 2. Sequence Variants in the Connexin
32 Promoter Region
|
|
|
GENOTYPING
A total of 35 X chromosome markers that cover the entire X chromosome
at intervals of 10 to 25 centimorgans were analyzed in genomic DNA from
the proband (patient II-7) and her 2 sons (patients III-4 and
III-5). Affected patients III-1 and IV-1 were not available
for study. Data on the concordant or discordant inheritance of markers
are presented in Table 3. The 2
brothers (one affected, the other unaffected) have discordantly
inherited markers DXS1047, DXS1105, DXS6789,
GATA144D04, DXS1061, DXS999, and DXS
996 distributed along the X chromosome. The remaining markers were
uninformative because the 2 maternal alleles could not be
distinguished.
|
|
|
|
Table 3. Genotyping of X-Chromosome Markers for CMTX Family*
|
|
|
COMMENT
The essential clinical features of this family are peripheral
sensorimotor neuropathy, spasticity, hyperreflexia, central conduction
delay, and an X-linked dominant pattern of inheritance. Elevated
cerebrospinal fluid protein was observed in 2 family members. A brain
MRI scan showed leukodystrophy in the proband. The 2 male patients had
early motor disability and hip dysplasia. One male patient has mental
retardation, but this could be unrelated since he may have suffered
birth injury. His nephew, aged 12 years, has essentially normal
intelligence, with only mild learning delays. The central
manifestations in this family led to extensive investigations,
including neurometabolic studies and exclusion of several of the
inherited ataxias. Evoked potentials documented central involvement in
3 family members; however, MRI was performed in only one subject.
Patient III-4 had an elevated urine sulfatide level which could
indicate metachromatic leukodystrophy, but this seems very unlikely
since metachromatic leukodystrophy is inherited as an autosomal
recessive condition, which is not consistent with the pedigree.
Leukocyte arylsulfatase A activity was normal. The observed inheritance
pattern in this family could be consistent with either autosomal
dominant or X-linked inheritance. Male-to-male transmission, which
would exclude X-linked inheritance, is not observed in this family. The
clinical picture, however, is more suggestive of X-linked dominant
inheritance because the 2 affected males had earlier onset, more severe
symptoms, and slower nerve conduction velocities than the affected
female relatives.
There are several previously reported conditions that overlap
with the features in our family. X-linked adrenoleukodystrophy is known
to show considerable phenotypic variability, which may include cerebral
demyelination, spastic paraparesis, peripheral neuropathy, Addison
disease, and relatively slow progression. This condition was excluded
by normal VLCFA levels in plasma in 3 subjects. The later onset
forms of Krabbe disease can show leukodystrophy, elevated CSF protein,
and peripheral nerve
involvement.12 This is inherited as
an autosomal recessive condition, in contrast with the inheritance
observed in this family. Pelizaeus-Merzbacher disease (PMD) is an
X-linked recessive disorder of widespread central nervous system
dysmyelination, spasticity, ataxia, and optic atrophy caused by
mutations in the PLP gene. Although Pelizaeus-Merzbacher
disease typically spares peripheral nerves, mutations involving the
first exon of the PLP gene may result in a milder
Pelizaeus-Merzbacher disease phenotype with demyelinating peripheral
neuropathy.10, 11
Central nervous system involvement has been reported in patients with
complicated variants of CMT. Thomas et al13 described 3
patients with peripheral myelin protein 22 (PMP22)
duplications and associated pyramidal signs, including bulbar and
cerebellar involvement. A PMP22 duplication was excluded in
our family by DNA testing. Recently, families with CMTX1 and
Cx32 mutations but atypical signs, such as severe
neuropathy14 or central nervous system involvement, have
been described, thus expanding the phenotype of
Cx32-associated neurological conditions.15, 16, 17 Some
families with CMTX1 have been shown to have mutations in the
neural-specific (P2) promoter region.9 In the family
reported here, sequencing of the neural-specific promoter and the
coding region did not show any of the previously reported mutations.
Our family meets the criteria for "probable CMTX" proposed by
Nicholson et al,18 with clinical and electrophysiologic
characteristics of CMTX, including a brainstem auditory evoked
potential I-V interpeak delay of greater than 4.6 ms. In their study of
23 probable CMTX families, 21 (91%) had Cx32 mutations. They
and others have reported X-linked dominant CMT families who do not have
mutations of Cx32.5, 19, 20 Comparison of the
present family with previously reported families with X-linked
neuropathy complicated by additional features shows that in the family
reported by Cowchock et al,21 males develop severe distal
weakness, sensory loss, and areflexia in the first few years, with
increased risk of social or intellectual delay. Obligate heterozygous
females, however, are asymptomatic. Linkage to markers in the
Xq24-26 region was demonstrated.22 Three families
described by Ionasescu et al23 showed linkage to
Xp22.2 or Xq26 markers. Their clinical features
included neuropathy and mental retardation, tremor, or spastic
paraparesis. All of these families differed from the one in the present
report by an X-linked recessive inheritance pattern. Whether one of
these conditions, or Cx32-negative X-linked dominant CMT, is
allelic to the condition reported here remains to be determined.
We performed genotyping of 35 markers on the X chromosome to determine
if the inheritance of the X chromosome in this family supported the
hypothesis of X-linked inheritance and to identify possible
candidate regions containing the disease-causing locus. Genotyping
studies showed that 7 informative markers distributed along the X
chromosome were inherited discordantly by the affected and unaffected
brothers, supporting X-linked inheritance.
These markers are located at Xp22.1 to Xp22.3
(DXS996, DXS999, DXS1061), Xp11.4
to Xp11.3 (GATA144D04), Xq21.33 to
Xq22.33 (DXS6789, DXS1105), and
Xq25 (DXS1047).
This family is too small for conventional linkage analysis, but
if additional families are reported, then exclusion mapping to rule out
discordant regions of the X chromosome in affected patients could be
used to narrow the candidate loci. Exclusion mapping was proposed by
Romeo et al24 as an approach to small families with rare,
X-linked disorders such as Rett syndrome. This disorder is nearly
always sporadic, but a few families with 2 or 3 affected members have
been described and were crucial to mapping and cloning the Rett
syndrome gene.25, 26, 27, 28, 29 Elucidating the molecular basis of the
condition in this and other families with novel phenotypes should add
to our understanding of the pathways in which these genes interact to
result in inherited disorders of myelination.
AUTHOR INFORMATION
Accepted for publication May 29, 2001.
This work was supported by a Paul Beeson Physician Faculty Scholar
Award through the American Federation for Aging Research (New York,
NY), and by the Hellman Family Foundation (San Francisco, Calif) (Dr
Hisama).
We thank the family members for participating; Barry Russman, MD, and
Giselle Petzinger, MD, for clinical evaluation; and Edward J. Novotny,
MD, for critically reading portions of the manuscript.
From the Departments of Neurology (Drs Hisama, Tekumalla, Russell, and
Goldstein) and Psychiatry
(Dr Russell), and the Neurogenetics
Program
(Drs Hisama and Tekumalla and Mss Lee and Vashlishan), Yale
University School of Medicine, New Haven, Conn; and the Division of
Ambulatory Care, Department of Medicine, Veterans Administration
Medical Center, West Haven, Conn (Ms Auld).
Corresponding author and reprints: Fuki M. Hisama, MD, Neurogenetics
Program, Department of Neurology, Yale University School of Medicine,
LCI 1000, PO Box 208018, New Haven, CT 06520-8018 (e-mail: fuki.hisama{at}yale.edu).
REFERENCES
 |  |
1. Dyck PJ, Chance P, Lebo R, Carney AJ. Hereditary motor and sensory
neuropathies. In: Dyck PJ, Thomas PK, Griffin JW, Low PA, Poduslo JF,
eds. Peripheral Neuropathy. 3rd ed. Philadelphia, Pa: WB
Saunders Co; 1993:1094-1136.
2. Keller MP, Chance PF. Inherited neuropathies: from gene to disease. Brain Pathol. 1999;9:327-341.
ISI
| PUBMED
3. Harding AE, Thomas PK. The clinical features of hereditary motor and
sensory neuropathy types I and II. Brain. 1980;103:259-280.
FREE FULL TEXT
4. Lupski JR. Charcot-Marie-Tooth disease: lessons in genetic mechanisms. Mol Med. 1998;4:3-11.
ISI
| PUBMED
5. Bergoffen J, Scherer SS, Wang S, et al. Connexin mutations in X-linked
Charcot-Marie-Tooth disease. Science. 1993;262:2039-2042.
FREE FULL TEXT
6. Phillips LH, Kelly TE, Schnatterly P, Parker D. Hereditary
motor-sensory neuropathy (HMSN): possible X-linked dominant
inheritance. Neurology. 1985;35:498-502.
FREE FULL TEXT
7. Nelis E, Haites N, van Broeckhoven C. Mutations in the peripheral
myelin genes and associated genes in inherited peripheral neuropathies. Hum Mutat. 1999;13:11-28.
FULL TEXT
|
ISI
| PUBMED
8. Ionasescu V, Searby C, Ionasescu R. Point mutations of the connexin32
(GJB1) gene in X-linked dominant Charcot-Marie-Tooth
neuropathy. Hum Mol Genet. 1994;3:355-358.
FREE FULL TEXT
9. Ionasescu VV, Searby C, Ionasescu R, Neuhaus IM, Werner R. Mutations in
the noncoding region of the connexin32 gene in X-linked dominant
Charcot-Marie-Tooth neuropathy. Neurology. 1996;47:541-544.
FREE FULL TEXT
10. Garbern JY, Cambi F, Tang X-M, et al. Proteolipid protein is necessary
in peripheral as well as central myelin. Neuron. 1997;19:205-218.
FULL TEXT
|
ISI
| PUBMED
11. Sistermans EA, de Wijs IJ, de Coo RFM, Smit LME, Menko FH, van Oost BA. A (G-to-A) mutation in the initiation codon of the
proteolipid protein gene causing a relatively mild form of
Pelizaeus-Merzbacher disease in a Dutch family. Hum Genet. 1996;97:337-339.
ISI
| PUBMED
12. Lyon G, Hagberg B, Evrard P, Allaire C, Pavone L, Vanier M. Symptomatology of late onset Krabbe's leukodystrophy: the European
experience. Dev Neurosci. 1991;13:240-244.
ISI
| PUBMED
13. Thomas PK, Marques W Jr, Davis MB, et al. The phenotypic manifestations
of chromosome 17p11.2 duplication. Brain. 1997;120:465-478.
FREE FULL TEXT
14. Felice KJ, Seltzer WK. Severe X-linked Charcot-Marie-Tooth neuropathy
due to new mutations [G59R(G C), W44X(G A)] in the connexin 32
gene. Eur Neurol. 2000;44:61-63.
ISI
| PUBMED
15. Panas M, Karadimas C, Avramopoulos D, Vassilopoulos D. Central nervous
system involvement in four patients with Charcot-Marie Tooth disease
with connexin32 extracellular mutations. J Neurol Neurosurg Psychiatry. 1998;65:947-948.
FREE FULL TEXT
16. Stojkovic T, Latour P, Vandenberghe A, Hurtevent JF, Vermersch P. Sensorineural deafness in X-linked Charcot-Marie-Tooth disease with
connexin 32 mutation (R142Q). Neurology. 1999;52:1010-1014.
FREE FULL TEXT
17. Bähr M, Andres F, Timmerman V, Nelis ME, Van Broeckhoven C, Dichgans J. Central visual, acoustic and motor pathway involvement in a
Charcot-Marie-Tooth family with an Asn205Ser mutation in the connexin
32 gene. J Neurol Neurosurg Psychiatry. 1999;66:202-206.
FREE FULL TEXT
18. Nicholson GA, Yeung L, Corbett A. Efficient neurophysiologic selection
of X-linked Charcot-Marie-Tooth families: ten novel mutations. Neurology. 1998;51:1412-1416.
FREE FULL TEXT
19. Bone LJ, Dahl N, Lensch MW, et al. New connexin 32 mutations associated
with X-linked Charcot-Marie-Tooth disease. Neurology. 1995;45:1863-1866.
FREE FULL TEXT
20. Rouger H, LeGuern E, Birouk N, et al. Charcot-Marie-Tooth disease with
intermediate motor nerve conduction velocities: characterization of 14
CX32 mutations in 35 families. Hum Mutat. 1997;10:443-452.
FULL TEXT
|
ISI
| PUBMED
21. Cowchock FS, Duckett SW, Streletz LJ, Graziani LJ, Jackson LG. X-linked
motor-sensory neuropathy type II with deafness and mental retardation:
a new disorder. Am J Med Genet. 1985;20:307-315.
FULL TEXT
|
ISI
| PUBMED
22. Priest JM, Fischbeck KH, Nouri N, Keats BJ. A locus for axonal
motor-sensory neuropathy with deafness and mental retardation maps to
Xq24-q26. Genomics. 1995;29:409-412.
FULL TEXT
|
ISI
| PUBMED
23. Ionasescu VV, Trofatter J, Haines JL, Summers AM, Ionasescu R, Searby C. Heterogeneity in X-linked recessive Charcot-Marie-Tooth neuropathy. Am J Hum Genet. 1991;48:1075-1083.
ISI
| PUBMED
24. Romeo G, Archidiacono N, Ferlini A, Rocchi M. Rett syndrome: lack of
association with fragile site Xp22 and strategy for genetic mapping of
X-linked new mutations. Am J Med Genet Suppl. 1986;1:355-359.
PUBMED
25. Archidiacono N, Lerone M, Rocchi M, et al. Rett syndrome: exclusion
mapping following the hypothesis of germinal mosaicism for new X-linked
mutations. Hum Genet. 1991;86:604-606.
ISI
| PUBMED
26. Curtis ARJ, Headland S, Lindsay S, et al. X chromosome linkage studies
in familial Rett syndrome. Hum Genet. 1993;90:551-555.
ISI
| PUBMED
27. Schanen NC, Roth Dahle EJ, Capozzoli F, Holm VA, Zoghbi HY, Francke U. A new Rett syndrome family consistent with X-linked inheritance expands
the X chromosome exclusion map. Am J Hum Genet. 1997;61:634-641.
ISI
| PUBMED
28. Ellison KA, Fill CP, Terwilliger J, et al. Examination of X chromosome
markers in Rett syndrome: exclusion mapping with a novel variation on
multilocus linkage analysis. Am J Hum Genet. 1992;50:278-297.
ISI
| PUBMED
29. Amir RE, Van den Veyver IB, Wan M, Tran CQ, Francke U, Zoghbi HY. Rett syndrome is caused by mutations in X-linked MECP2, encoding
methyl-CpG-binding protein 2. Nat Genet. 1999;23:185-188.
FULL TEXT
|
ISI
| PUBMED
CiteULike Connotea Del.icio.us Digg Reddit Technorati Twitter
What's this?
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES
Central Nervous System Involvement in Hereditary Neuropathy With Liability to Pressure Palsies: Description of a Large Family With This Association
Sanahuja et al.
Arch Neurol 2005;62:1911-1914.
ABSTRACT
| FULL TEXT
|