You are seeing this message because your Web browser does not support basic Web standards. Find out more about why this message is appearing and what you can do to make your experience on this site better.


ABOUT ARCHIVES
Advanced Search

Welcome   | My Account | E-mail Alerts | Access Rights | Sign In


  Vol. 58 No. 11, November 2001 TABLE OF CONTENTS
  Archives
  •  Online Features
  Observation
 This Article
 •Abstract
 •PDF
 • Reply to article
 •Send to a friend
 • Save in My Folder
 •Save to citation manager
 •Permissions
 Citing Articles
 •Citation map
 •Citing articles on HighWire
 •Citing articles on Web of Science (4)
 •Contact me when this article is cited
 Related Content
 •Similar articles in this journal
 Topic Collections
 •Neurogenetics
 •Neuromuscular diseases
 •Genetic Disorders
 •Alert me on articles by topic
 Social Bookmarking
  Add to CiteULike Add to Connotea Add to Del.icio.us Add to Digg Add to Reddit Add to Technorati Add to Twitter What's this?

Clinical and Molecular Studies in a Family With Probable X-linked Dominant Charcot-Marie-Tooth Disease Involving the Central Nervous System

Fuki M. Hisama, MD; Helen H. Lee, BS; Amy Vashlishan; Poornima Tekumalla, PhD; David S. Russell, MD, PhD; Elizabeth Auld, PA; Jonathan M. Goldstein, MD

Arch Neurol. 2001;58:1891-1896.

ABSTRACT

Objective  To investigate the clinical and molecular characteristics of an apparently X-linked dominant form of Charcot-Marie-Tooth (CMT) disease in a family with central nervous system involvement and additional features.

Background  Charcot-Marie-Tooth disease may be inherited as an autosomal dominant, autosomal recessive, or X-linked trait. In the X-linked dominant form of CMT, females demonstrate milder clinical and electrophysiological features compared with their male relatives.

Methods  Clinical and related examinations were performed in 4 affected individuals from a family with a novel form of CMT affecting males more severely than females. DNA analysis of the connexin 32 (Cx32) gene and proteolipid protein (PLP) gene was performed. We genotyped 3 members of the family to determine which regions of the X chromosome were inherited discordantly in the affected and unaffected brothers.

Results  Clinical studies revealed significant spasticity, hyperreflexia, and delayed central conduction, in addition to peripheral neuropathy. Nerve conduction velocities were slower in the affected males than in the affected females. Direct DNA sequencing of the Cx32 coding region and neural-specific promoter were normal. A PLP null mutation was excluded. Levels of very long chain fatty acids were normal. Genotyping studies of the X chromosome supported X-linked inheritance of the neuropathy.

Conclusions  This family differs from others with hereditary motor and sensory neuropathic diseases by the presence of upper motor neuron signs and additional features. The clinical features and inheritance pattern are consistent with X-linked dominant inheritance or autosomal dominant inheritance.



INTRODUCTION
 Jump to Section
 •Top
 •Introduction
 •Patients and methods
 •Results
 •Comment
 •Author information
 •References

CHARCOT-Marie-Tooth (CMT) disease is a clinically and genetically heterogeneous group of peripheral nerve disorders characterized by distal weakness, atrophy, sensory loss, and decreased tendon reflexes.1, 2 Charcot-Marie-Tooth has been classified according to the pattern of inheritance and whether the abnormalities affect primarily myelin (CMT1) or axons (CMT2). Median motor nerve conduction velocities distinguish the 2 types.3 Genetic studies have identified mutations in several peripheral myelin genes: peripheral myelin protein 22 (PMP22), myelin protein zero (P0), and early growth response 2 (EGR2).4 The X-linked dominant form of CMT (CMTX) was mapped to Xq13.1, and subsequently, mutations in connexin 32 (Cx32) were shown to cosegregate with the phenotype.5 In CMTX families, males generally have a more severe phenotype than females, with onset of symptoms at an earlier age. Nerve conduction velocities are typically slower in affected males compared with their affected female relatives.6 More than 160 mutations in the Cx32 gene have been reported in CMTX families.7

We describe here the clinical and genetic studies in a family with an apparently novel form of X-linked dominant CMT with spasticity and central conduction delay.


PATIENTS AND METHODS
 Jump to Section
 •Top
 •Introduction
 •Patients and methods
 •Results
 •Comment
 •Author information
 •References

PATIENTS

Clinical information and family history were obtained by inpatient or outpatient evaluations in the Neurology Department at Yale New Haven Hospital, New Haven, Conn, or the West Haven Veteran's Hospital, West Haven, Conn. Clinical records from Newington Children's Hospital, Newington, Conn, for patient IV-1 were reviewed. Additional family history was obtained through interviews with family members, one of whom is a nurse. Written informed consent was obtained from participants according to a protocol approved by the Human Investigations Committee at Yale. Genomic DNA was extracted from peripheral blood lymphocytes using standard methods. Patient III-1 twice declined to have blood drawn from herself or her son.

ELECTROPHYSIOLOGICAL EVALUATION

All nerve conduction studies were performed by one of us (J.M.G.) using Dantech (Counterpoint MK2 or Neuromatic 2000; Medtronic Functional Diagnostics, Shoreview, Minn) equipment. Standard techniques were applied to measure nerve conduction. Visual evoked potentials were obtained by pattern reversal to monocular full-field stimulation using 30-minute checks, reversing at a rate of 1.9 Hz. Brainstem auditory evoked potentials were performed using monaural stimulation with rarefaction clicks with a 100-ms duration at a rate of 11.1 Hz. Somatosensory evoked potentials were elicited by unilateral percutaneous stimulation of the median nerve at a threshold just above motor threshold, and recorded from the brachial plexus (Erb potential), cervical spine at C2 (N13), and the contralateral parietal area (N19) with a frontal (Fz) reference.

ANALYSIS OF Cx32

The Cx32 gene coding region (exon 2) was amplified by polymerase chain reaction (PCR) using previously published primer sets.8 The reaction mixture (25 µL) contained 100 ng of genomic DNA, 10mM Tris-HCl (pH, 8.3), 60mM KCl, 7 pmol of each primer, 1.25mM MgCl2, 2.5 U of AmpliTaq DNA polymerase (Applied Biosystems, Foster City, Calif). After an initial denaturation step at 95°C for 5 minutes, PCR was performed for 35 cycles at 95°C for 1 minute, 60°C for 1 minute, and 72°C for 1 minute, followed by a final extension step of 72°C for 5 minutes. The PCR products were analyzed on a 1% agarose gel, purified by Qiaquick columns (Qiagen, Valencia, Calif) and directly sequenced using an automated 373A sequencer (Applied Biosystems). Sequence comparisons were done manually and with BLAST software (National Center for Biotechnology Information, Bethesda, Md).

ANALYSIS OF THE Cx32 PROMOTER REGION

The Cx32 gene promoter P2 region was amplified using primers P7 and P11 and conditions previously reported9 in a 50-µL reaction containing 100 ng of genomic DNA. The size of the product was verified by electrophoresis on a 2% agarose gel, and sequenced using an Applied Biosystems 373A sequencer. In addition, a new primer, P9, was designed (antisense, -397 to -417), 5' CACCCAGACAGGTCCCCTATG 3', and used with the published primer P16 (antisense, -745 to -725) to amplify a 348–base pair (bp) product for restriction digestion.9 Restriction digests were performed at 37°C with 10 µL of the PCR product and 20 U of BanII (New England Biolabs, Beverly, Mass) for 2 hours.

ANALYSIS OF THE PROTEOLIPID PROTEIN GENE

We excluded the G-4 deletion described by Garbern et al10 and other mutations in exon 1 of the proteolipid protein (PLP) gene by using the PCR-directed site-specific mutagenesis test developed by Sistermans et al.11 Briefly, a mutated forward primer was used with an intron 1–specific reverse primer to introduce a NcoI site into the resulting 114-bp PCR fragment. Restriction digestion with NcoI from a wild-type allele results in 85-bp and 29-bp fragments; an exon 1 mutation will prevent this digestion.

GENOTYPING

X-chromosomal microsatellite markers were tested by use of primers available from Research Genetics (Huntington, Ala). Details regarding primer sequences and PCR conditions are available from the Genome Database (http://gdbwww.gdb.org). Locations and genetic distances were obtained from a Marshfield chromosome map (http://research.marshfieldclinic.org/genetics/), the Integrated X-Chomosome Database, version 2.3 (http://ixdb.molgen.mpg.de/), and the Cooperative Human Linkage Center (http://cgap.nci.nih.gov/CHLC). Polymerase chain reaction amplifications were performed in a 25-µL reaction containing 10 to 100 ng of genomic DNA, 10mM Tris-HCl (pH, 8.3), 50mM KCl, 2.5mM MgCl2, 7 pmol each of sense and antisense primer, 250 µM of dNTPS, and 0.25 U of Taq polymerase (Perkin-Elmer). Ten to 25 ng of PCR product was diluted to 6 µL with denaturing solution (94% formamide, 0.05% xylene cyanol solution, and 0.04% bromophenol blue), and heat denatured at 95°C for 5 minutes. Samples were separated at 5°C or 20°C on 12.5% polyacrylamide gels (GeneGel Excel 12.5/24; Amersham Pharmacia Biotech AB, Uppsala, Sweden) from the manufacturer using the GenePhor Electrophoresis Unit (Amersham Pharmacia Biotech). Following the separation, the DNA was stained using the Hoefer Automated Gel Stainer with the PlusOne DNA SilverStaining Kit (Amersham Pharmacia Biotech).


RESULTS
 Jump to Section
 •Top
 •Introduction
 •Patients and methods
 •Results
 •Comment
 •Author information
 •References

CLINICAL FINDINGS

Patient II-7

The proband (patient II-7, Figure 1), a 56-year-old woman, was born with a foot deformity and was a clumsy child. She developed gait instability at age 20 years. At age 18 years, she completed boot camp and subsequently served 2 years in the military. She slowly developed progressive weakness and sensory loss in the distal extremities and a wide-based gait. By her late 30s she used a cane; a decade later she used a walker; and in her early 50s, she began using a wheelchair for long distances. The ethnic background of the family is English and French on the paternal side and Pennsylvania Dutch on the maternal side. A recent neurologic examination showed dysarthric speech, spasticity in the legs, distal atrophy in the arms and legs, hyperreflexia in the arms, ankle areflexia, a left Babinski sign, and pes cavus. The following test results were normal: creatine kinase, aldolase, rheumatoid factor, antinuclear antibody, C-reactive protein, folate, and vitamin B12 levels; brain computed tomography scan; myelogram; and phytanic acid level. Results of commercial DNA testing (Athena Diagnostics, Worcester, Mass) for spinocerebellar ataxia 1 (SCA1), SCA2, SCA3, Friedreich ataxia, the peripheral myelin protein 22 (PMP22) duplication, and Cx32 mutations were normal. Cerebrospinal fluid protein level was elevated on 2 occasions (89 mg/dL and 69 mg/dL [normal range, 15-45 mg/dL]). A magnetic resonance imaging (MRI) scan of the brain and spine at age 47 years showed bilateral increased signal in the white matter, with a normal corpus callosum, mild atrophy of the distal thoracic cord, and conus medullaris. Evoked potentials were performed at age 42 years. Visual evoked potential showed normal response on the right side, and small amplitude and delayed potentials on the left side. There was a history of childhood amblyopia. Somatosensory evoked potentials showed grossly delayed, small-amplitude spinal and cerebral potentials. Brain stem auditory evoked potentials showed normal eighth-nerve volleys, but central potentials were delayed and of reduced amplitude. In summary, these suggested both central and peripheral conduction delay. Nerve conduction studies for the 4 affected individuals are summarized in Table 1. Results were consistent with demyelinating and axonal sensorimotor neuropathy. Significantly, nerve conduction velocities were slower in the males than the females, and were near normal in an obligate gene carrier female (patient III-1).



View larger version (19K):
[in this window]
[in a new window]
The family pedigree. Patient II-7 is the proband, indicated by an arrow. Clinical and electrophysiological examinations were performed on patients II-7, III-1, III-4 and IV-1. Genotyping was performed on patients II-7, III-4 and III-5.



View this table:
[in this window]
[in a new window]
Table 1. Clinical Features and Peripheral Nerve Conduction Studies*


Patient III-4

The proband's son is a 33-year-old man who was born after a complicated forceps delivery with face presentation and had a childhood learning disability. He had bronchitis as an infant, talked at age 3 years, and walked at age 9 years with long leg braces. His clinical features included mental retardation, a total of 3 seizures, nystagmus, severe kyphoscoliosis, hip dislocation, and contractures of the hips, knees, and wrists by his late 20s. His examination was remarkable for limited and dysarthric speech, nystagmus, peripheral neuropathy, distal atrophy, pes cavus, spasticity, increased patellar reflexes, absent ankle reflexes, and plantar responses. He is confined to bed and stretcher because of the scoliosis and contractures, is fed by a gastrostomy tube, and lives in a group home. He had the following normal test results: SCA1 and SCA3; very long chain fatty acid (VLCFA) and lactate levels; and hexosaminidase A and B, arylsulfatase A, galactocerebrosidase, and ß-mannosidase activities. Urine sulfatide level was mildly elevated in one test. Results of a retinal examination were normal. Audiometry results were normal.

Patient III-1

The proband's daughter is a 36-year-old woman with a normal early history. She walked at 14 months. She began to have episodes of twisting her ankles and occasional falls as a teenager. On examination at age 23 years, she had pes cavus, distal leg atrophy, normal muscle strength including peroneals, claw toes, and mild spasticity of the legs. Levels of VLCFA were normal. At age 27 years, visual and brainstem auditory evoked potentials were done. The P100 latencies were normal (left, 98 ms; right, 89 ms) but with an interocular latency difference of 9 ms (+2 SD). Brainstem auditory evoked potential showed a prolonged wave III-V interpeak interval of 2.44 ms and a wave I-V interpeak interval of 4.60 ms following right ear stimulation. This suggests a conduction defect between the lower pons and the midbrain and abnormal latency intensity function of wave V bilaterally, suggesting possible associated conductive hearing loss. Formal audiometry was not performed.

Patient IV-1

The 12-year-old (current age) grandson of the proband has motor and sensory neuropathy, bilateral hip dysplasia, and spasticity. He had peripheral neuropathy as well as spasticity by age 4 years. He underwent eye surgery for strabismus and had multiple leg operations, including adductor tenotomies, lengthening of the Achilles tendons, and femoral osteotomies. He walks with leg braces and a walker. He uses a wheelchair for long distances. He is in special education for reading and math, and takes regular classes for other subjects. Test results included normal lactate and pyruvate levels in blood and CSF, and normal ammonia and VLCFA levels. Cerebral spinal fluid protein level was elevated at 54 mg/dL (normal range, 15-45 mg/dL). Brainstem auditory evoked potential was abnormal with no wave V recorded on the right and a reproducible wave V on the left. The left wave I-III interpeak latency was 2.76 ms, the left wave I-V interpeak latency was 4.54 ms, and the right wave I-III interpeak latency was 3.10 ms, which was consistent with conduction delay between the eighth nerve and lower pons.

MOLECULAR STUDIES OF Cx32 AND THE PLP GENES

Direct DNA sequencing of the coding region (exon 2) of Cx32 in patient II-7 by both commercial and research testing, and of patient III-4 by research testing did not detect any mutations. By sequencing the neural-specific promoter region (exon 1b) in these 2 individuals, we identified 4 sequence variants (Table 2) compared with the published sequence (Genbank L47127). An A-to-C transversion at -544 bp from the ATG start site resulted in a new BanII restriction fragment-length polymorphism. All 4 sequence variants were confirmed by sequencing or restriction digestion of the product of separate PCR reactions. Each variant was found in 16 of 16 healthy controls, with no evidence of CMT or spasticity on neurologic examination. The PCR-directed site-specific mutagenesis test did not detect mutations in the small (4 nucleotides) coding region of exon 1 of the PLP gene in patients II-7, III-4, and III-5.


View this table:
[in this window]
[in a new window]
Table 2. Sequence Variants in the Connexin 32 Promoter Region


GENOTYPING

A total of 35 X chromosome markers that cover the entire X chromosome at intervals of 10 to 25 centimorgans were analyzed in genomic DNA from the proband (patient II-7) and her 2 sons (patients III-4 and III-5). Affected patients III-1 and IV-1 were not available for study. Data on the concordant or discordant inheritance of markers are presented in Table 3. The 2 brothers (one affected, the other unaffected) have discordantly inherited markers DXS1047, DXS1105, DXS6789, GATA144D04, DXS1061, DXS999, and DXS 996 distributed along the X chromosome. The remaining markers were uninformative because the 2 maternal alleles could not be distinguished.


View this table:
[in this window]
[in a new window]
Table 3. Genotyping of X-Chromosome Markers for CMTX Family*



COMMENT
 Jump to Section
 •Top
 •Introduction
 •Patients and methods
 •Results
 •Comment
 •Author information
 •References

The essential clinical features of this family are peripheral sensorimotor neuropathy, spasticity, hyperreflexia, central conduction delay, and an X-linked dominant pattern of inheritance. Elevated cerebrospinal fluid protein was observed in 2 family members. A brain MRI scan showed leukodystrophy in the proband. The 2 male patients had early motor disability and hip dysplasia. One male patient has mental retardation, but this could be unrelated since he may have suffered birth injury. His nephew, aged 12 years, has essentially normal intelligence, with only mild learning delays. The central manifestations in this family led to extensive investigations, including neurometabolic studies and exclusion of several of the inherited ataxias. Evoked potentials documented central involvement in 3 family members; however, MRI was performed in only one subject. Patient III-4 had an elevated urine sulfatide level which could indicate metachromatic leukodystrophy, but this seems very unlikely since metachromatic leukodystrophy is inherited as an autosomal recessive condition, which is not consistent with the pedigree. Leukocyte arylsulfatase A activity was normal. The observed inheritance pattern in this family could be consistent with either autosomal dominant or X-linked inheritance. Male-to-male transmission, which would exclude X-linked inheritance, is not observed in this family. The clinical picture, however, is more suggestive of X-linked dominant inheritance because the 2 affected males had earlier onset, more severe symptoms, and slower nerve conduction velocities than the affected female relatives.

There are several previously reported conditions that overlap with the features in our family. X-linked adrenoleukodystrophy is known to show considerable phenotypic variability, which may include cerebral demyelination, spastic paraparesis, peripheral neuropathy, Addison disease, and relatively slow progression. This condition was excluded by normal VLCFA levels in plasma in 3 subjects. The later onset forms of Krabbe disease can show leukodystrophy, elevated CSF protein, and peripheral nerve involvement.12 This is inherited as an autosomal recessive condition, in contrast with the inheritance observed in this family. Pelizaeus-Merzbacher disease (PMD) is an X-linked recessive disorder of widespread central nervous system dysmyelination, spasticity, ataxia, and optic atrophy caused by mutations in the PLP gene. Although Pelizaeus-Merzbacher disease typically spares peripheral nerves, mutations involving the first exon of the PLP gene may result in a milder Pelizaeus-Merzbacher disease phenotype with demyelinating peripheral neuropathy.10, 11

Central nervous system involvement has been reported in patients with complicated variants of CMT. Thomas et al13 described 3 patients with peripheral myelin protein 22 (PMP22) duplications and associated pyramidal signs, including bulbar and cerebellar involvement. A PMP22 duplication was excluded in our family by DNA testing. Recently, families with CMTX1 and Cx32 mutations but atypical signs, such as severe neuropathy14 or central nervous system involvement, have been described, thus expanding the phenotype of Cx32-associated neurological conditions.15, 16, 17 Some families with CMTX1 have been shown to have mutations in the neural-specific (P2) promoter region.9 In the family reported here, sequencing of the neural-specific promoter and the coding region did not show any of the previously reported mutations. Our family meets the criteria for "probable CMTX" proposed by Nicholson et al,18 with clinical and electrophysiologic characteristics of CMTX, including a brainstem auditory evoked potential I-V interpeak delay of greater than 4.6 ms. In their study of 23 probable CMTX families, 21 (91%) had Cx32 mutations. They and others have reported X-linked dominant CMT families who do not have mutations of Cx32.5, 19, 20 Comparison of the present family with previously reported families with X-linked neuropathy complicated by additional features shows that in the family reported by Cowchock et al,21 males develop severe distal weakness, sensory loss, and areflexia in the first few years, with increased risk of social or intellectual delay. Obligate heterozygous females, however, are asymptomatic. Linkage to markers in the Xq24-26 region was demonstrated.22 Three families described by Ionasescu et al23 showed linkage to Xp22.2 or Xq26 markers. Their clinical features included neuropathy and mental retardation, tremor, or spastic paraparesis. All of these families differed from the one in the present report by an X-linked recessive inheritance pattern. Whether one of these conditions, or Cx32-negative X-linked dominant CMT, is allelic to the condition reported here remains to be determined.

We performed genotyping of 35 markers on the X chromosome to determine if the inheritance of the X chromosome in this family supported the hypothesis of X-linked inheritance and to identify possible candidate regions containing the disease-causing locus. Genotyping studies showed that 7 informative markers distributed along the X chromosome were inherited discordantly by the affected and unaffected brothers, supporting X-linked inheritance.

These markers are located at Xp22.1 to Xp22.3 (DXS996, DXS999, DXS1061), Xp11.4 to Xp11.3 (GATA144D04), Xq21.33 to Xq22.33 (DXS6789, DXS1105), and Xq25 (DXS1047).

This family is too small for conventional linkage analysis, but if additional families are reported, then exclusion mapping to rule out discordant regions of the X chromosome in affected patients could be used to narrow the candidate loci. Exclusion mapping was proposed by Romeo et al24 as an approach to small families with rare, X-linked disorders such as Rett syndrome. This disorder is nearly always sporadic, but a few families with 2 or 3 affected members have been described and were crucial to mapping and cloning the Rett syndrome gene.25, 26, 27, 28, 29 Elucidating the molecular basis of the condition in this and other families with novel phenotypes should add to our understanding of the pathways in which these genes interact to result in inherited disorders of myelination.


AUTHOR INFORMATION
 Jump to Section
 •Top
 •Introduction
 •Patients and methods
 •Results
 •Comment
 •Author information
 •References

Accepted for publication May 29, 2001.

This work was supported by a Paul Beeson Physician Faculty Scholar Award through the American Federation for Aging Research (New York, NY), and by the Hellman Family Foundation (San Francisco, Calif) (Dr Hisama).

We thank the family members for participating; Barry Russman, MD, and Giselle Petzinger, MD, for clinical evaluation; and Edward J. Novotny, MD, for critically reading portions of the manuscript.

From the Departments of Neurology (Drs Hisama, Tekumalla, Russell, and Goldstein) and Psychiatry (Dr Russell), and the Neurogenetics Program (Drs Hisama and Tekumalla and Mss Lee and Vashlishan), Yale University School of Medicine, New Haven, Conn; and the Division of Ambulatory Care, Department of Medicine, Veterans Administration Medical Center, West Haven, Conn (Ms Auld).

Corresponding author and reprints: Fuki M. Hisama, MD, Neurogenetics Program, Department of Neurology, Yale University School of Medicine, LCI 1000, PO Box 208018, New Haven, CT 06520-8018 (e-mail: fuki.hisama{at}yale.edu).


REFERENCES
 Jump to Section
 •Top
 •Introduction
 •Patients and methods
 •Results
 •Comment
 •Author information
 •References

1. Dyck PJ, Chance P, Lebo R, Carney AJ. Hereditary motor and sensory neuropathies. In: Dyck PJ, Thomas PK, Griffin JW, Low PA, Poduslo JF, eds. Peripheral Neuropathy. 3rd ed. Philadelphia, Pa: WB Saunders Co; 1993:1094-1136.
2. Keller MP, Chance PF. Inherited neuropathies: from gene to disease. Brain Pathol. 1999;9:327-341. ISI | PUBMED
3. Harding AE, Thomas PK. The clinical features of hereditary motor and sensory neuropathy types I and II. Brain. 1980;103:259-280. FREE FULL TEXT
4. Lupski JR. Charcot-Marie-Tooth disease: lessons in genetic mechanisms. Mol Med. 1998;4:3-11. ISI | PUBMED
5. Bergoffen J, Scherer SS, Wang S, et al. Connexin mutations in X-linked Charcot-Marie-Tooth disease. Science. 1993;262:2039-2042. FREE FULL TEXT
6. Phillips LH, Kelly TE, Schnatterly P, Parker D. Hereditary motor-sensory neuropathy (HMSN): possible X-linked dominant inheritance. Neurology. 1985;35:498-502. FREE FULL TEXT
7. Nelis E, Haites N, van Broeckhoven C. Mutations in the peripheral myelin genes and associated genes in inherited peripheral neuropathies. Hum Mutat. 1999;13:11-28. FULL TEXT | ISI | PUBMED
8. Ionasescu V, Searby C, Ionasescu R. Point mutations of the connexin32 (GJB1) gene in X-linked dominant Charcot-Marie-Tooth neuropathy. Hum Mol Genet. 1994;3:355-358. FREE FULL TEXT
9. Ionasescu VV, Searby C, Ionasescu R, Neuhaus IM, Werner R. Mutations in the noncoding region of the connexin32 gene in X-linked dominant Charcot-Marie-Tooth neuropathy. Neurology. 1996;47:541-544. FREE FULL TEXT
10. Garbern JY, Cambi F, Tang X-M, et al. Proteolipid protein is necessary in peripheral as well as central myelin. Neuron. 1997;19:205-218. FULL TEXT | ISI | PUBMED
11. Sistermans EA, de Wijs IJ, de Coo RFM, Smit LME, Menko FH, van Oost BA. A (G-to-A) mutation in the initiation codon of the proteolipid protein gene causing a relatively mild form of Pelizaeus-Merzbacher disease in a Dutch family. Hum Genet. 1996;97:337-339. ISI | PUBMED
12. Lyon G, Hagberg B, Evrard P, Allaire C, Pavone L, Vanier M. Symptomatology of late onset Krabbe's leukodystrophy: the European experience. Dev Neurosci. 1991;13:240-244. ISI | PUBMED
13. Thomas PK, Marques W Jr, Davis MB, et al. The phenotypic manifestations of chromosome 17p11.2 duplication. Brain. 1997;120:465-478. FREE FULL TEXT
14. Felice KJ, Seltzer WK. Severe X-linked Charcot-Marie-Tooth neuropathy due to new mutations [G59R(G->C), W44X(G->A)] in the connexin 32 gene. Eur Neurol. 2000;44:61-63. ISI | PUBMED
15. Panas M, Karadimas C, Avramopoulos D, Vassilopoulos D. Central nervous system involvement in four patients with Charcot-Marie Tooth disease with connexin32 extracellular mutations. J Neurol Neurosurg Psychiatry. 1998;65:947-948. FREE FULL TEXT
16. Stojkovic T, Latour P, Vandenberghe A, Hurtevent JF, Vermersch P. Sensorineural deafness in X-linked Charcot-Marie-Tooth disease with connexin 32 mutation (R142Q). Neurology. 1999;52:1010-1014. FREE FULL TEXT
17. Bähr M, Andres F, Timmerman V, Nelis ME, Van Broeckhoven C, Dichgans J. Central visual, acoustic and motor pathway involvement in a Charcot-Marie-Tooth family with an Asn205Ser mutation in the connexin 32 gene. J Neurol Neurosurg Psychiatry. 1999;66:202-206. FREE FULL TEXT
18. Nicholson GA, Yeung L, Corbett A. Efficient neurophysiologic selection of X-linked Charcot-Marie-Tooth families: ten novel mutations. Neurology. 1998;51:1412-1416. FREE FULL TEXT
19. Bone LJ, Dahl N, Lensch MW, et al. New connexin 32 mutations associated with X-linked Charcot-Marie-Tooth disease. Neurology. 1995;45:1863-1866. FREE FULL TEXT
20. Rouger H, LeGuern E, Birouk N, et al. Charcot-Marie-Tooth disease with intermediate motor nerve conduction velocities: characterization of 14 CX32 mutations in 35 families. Hum Mutat. 1997;10:443-452. FULL TEXT | ISI | PUBMED
21. Cowchock FS, Duckett SW, Streletz LJ, Graziani LJ, Jackson LG. X-linked motor-sensory neuropathy type II with deafness and mental retardation: a new disorder. Am J Med Genet. 1985;20:307-315. FULL TEXT | ISI | PUBMED
22. Priest JM, Fischbeck KH, Nouri N, Keats BJ. A locus for axonal motor-sensory neuropathy with deafness and mental retardation maps to Xq24-q26. Genomics. 1995;29:409-412. FULL TEXT | ISI | PUBMED
23. Ionasescu VV, Trofatter J, Haines JL, Summers AM, Ionasescu R, Searby C. Heterogeneity in X-linked recessive Charcot-Marie-Tooth neuropathy. Am J Hum Genet. 1991;48:1075-1083. ISI | PUBMED
24. Romeo G, Archidiacono N, Ferlini A, Rocchi M. Rett syndrome: lack of association with fragile site Xp22 and strategy for genetic mapping of X-linked new mutations. Am J Med Genet Suppl. 1986;1:355-359. PUBMED
25. Archidiacono N, Lerone M, Rocchi M, et al. Rett syndrome: exclusion mapping following the hypothesis of germinal mosaicism for new X-linked mutations. Hum Genet. 1991;86:604-606. ISI | PUBMED
26. Curtis ARJ, Headland S, Lindsay S, et al. X chromosome linkage studies in familial Rett syndrome. Hum Genet. 1993;90:551-555. ISI | PUBMED
27. Schanen NC, Roth Dahle EJ, Capozzoli F, Holm VA, Zoghbi HY, Francke U. A new Rett syndrome family consistent with X-linked inheritance expands the X chromosome exclusion map. Am J Hum Genet. 1997;61:634-641. ISI | PUBMED
28. Ellison KA, Fill CP, Terwilliger J, et al. Examination of X chromosome markers in Rett syndrome: exclusion mapping with a novel variation on multilocus linkage analysis. Am J Hum Genet. 1992;50:278-297. ISI | PUBMED
29. Amir RE, Van den Veyver IB, Wan M, Tran CQ, Francke U, Zoghbi HY. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet. 1999;23:185-188. FULL TEXT | ISI | PUBMED


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter     What's this?

THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES

Central Nervous System Involvement in Hereditary Neuropathy With Liability to Pressure Palsies: Description of a Large Family With This Association
Sanahuja et al.
Arch Neurol 2005;62:1911-1914.
ABSTRACT | FULL TEXT  





HOME | CURRENT ISSUE | PAST ISSUES | TOPIC COLLECTIONS | CME | SUBMIT | SUBSCRIBE | HELP
CONDITIONS OF USE | PRIVACY POLICY | CONTACT US | SITE MAP
 
© 2001 American Medical Association. All Rights Reserved.