 |
 |

Genetic and Clinical Analysis of Spinocerebellar Ataxia Type 8 Repeat Expansion in Italy
Elena Cellini, PhD;
Benedetta Nacmias, PhD;
Paolo Forleo, MD;
Silvia Piacentini, MD;
Bianca Maria Guarnieri, MD;
Antonio Serio, MD;
Antonio Calabrò, MD;
Daniela Renzi, PhD;
Sandro Sorbi, MD
Arch Neurol. 2001;58:1856-1859.
ABSTRACT
 |  |
Background The spinocerebellar ataxias (SCAs) are
clinically heterogeneous disorders caused by triplet repeat expansions
in the sequence of specific disease genes. Spinocerebellar ataxia type
8 (SCA8), originally described in a family characterized by pure
cerebellar ataxia with slow disease progression, presents with
expansion of combined CTA/CTG repeats.
Objective To perform SCA8 repeat expansion analysis
in a heterogeneous group of ataxic patients, to determine the
prevalence of this mutation in our patients and establish the frequency
of expanded CTA/CTG repeats in a large group of control subjects.
Patients One hundred sixty-seven patients affected by
sporadic, autosomal dominant and recessive hereditary ataxia were
clinically examined and analyzed for SCA8 expansion. We
further studied 161 control subjects and 125 patients with psychiatric
disorders.
Results We found abnormally expanded CTA/CTG repeats in 5
ataxic patients, 3 of them characterized by pure cerebellar ataxia. One
patient had vitamin E deficiency and 1 patient with a sporadic case was
affected by gluten ataxia. No evidence of expanded alleles was found in
healthy control subjects and in patients with psychiatric disorders.
Conclusions Our data support the evidence that CTG expansions
may be linked to SCA8, since the pathogenic expansions have
been found only among patients with genetically unidentified forms of
hereditary and sporadic ataxia. Patients carrying expanded alleles
present peculiar phenotypic features, thus suggesting that unknown
additional factors could probably predispose to the disease.
INTRODUCTION
SPINOCEREBELLAR ataxia type 8 (SCA8) is the first form of ataxia caused by a CTG triplet
repeat expansion. This disorder, originally described in a family
characterized by pure cerebellar ataxia with slow disease progression,
shows clinical features similar to those of other spinocerebellar
ataxias (SCAs), including limb and truncal ataxia, dysarthria, and
nystagmus. The SCA8 has been distinguished among triplet disease
disorders both in terms of the transcribed repeat motif (CTG) and for
its location in the noncoding region of the gene, resulting in an
untranslated expansion at the 3' end of RNA.1 The existence
of an antisense transcript, encoding a novel actin-binding protein
(KLHL1), has been recently reported,2 suggesting that the
pathogenic effect of SCA8 expansion may result in an
alteration of KLHL1 messenger RNA stability or processing. However, the
role of CTG expansion in the pathogenesis of SCA8 and the molecular
mechanism responsible for the disease remain to be clarified.
The CTG repeat tracts on expanded alleles are often
interrupted by other triplet motifs (CCG, CTC,
CCA, and CTT, with a more frequent polymorphic
CTAn). These interruptions within the CTG repeat
tract might potentially stabilize such expansions, influencing the
penetrance of expanded SCA8 alleles.3, 4
Normal alleles have a repeat size varying from 16 to 91 combined
CTG/CTA repeats, whereas patients with SCA8 carry expanded
alleles with 107 to 127 pure CTGs. In addition, pathogenic CTG
expansions, resulting from maternal inheritance, seem to represent a
peculiar feature of the disease, in contrast to the majority of
dominant SCAs showing paternal transmission.5, 6 The
evidence that expanded CTG repeats undergo significant length changes
during intergenerational transmission may explain the reduced
penetrance of SCA8 ataxia.4, 7 Possible pathogenic
combined repeats, ranging from 92 to 250 CTA/CTG,
have been reported in ataxic
patients since the original report.1 In addition, recent
collaborative studies,8, 9, 10 using large panels of patients
and control subjects, reported nonspecific SCA8 pathogenic
expansions in healthy subjects and in patients with different
neurologic and psychiatric disorders, thus suggesting that CTG
expansions linked to SCA8 may represent rare polymorphisms. We
have analyzed SCA8 CTA/CTG expansions in a heterogeneous group
of ataxic patients to better define the molecular features of these
peculiar repeats and to individuate a common clinical phenotype
characterizing this new form of ataxia. Moreover, we have investigated
the prevalence of SCA8 expansion through triplet analysis of a
pool of psychiatric (bipolar and schizophrenic) patients and control
individuals.
PATIENTS AND METHODS
PATIENTS
We analyzed 167 patients with ataxia (mean ± SD age,
48.83 ± 19.44 years), including 77 patients with
autosomal dominant cerebellar ataxia, 25 subjects with autosomal
recessive cerebellar ataxia, and 65 patients with sporadic cases, 56 of
whom had idiopathic late-onset cerebellar ataxia. Clinical diagnosis
was made according to the criteria proposed by Harding.11
In particular, idiopathic late-onset cerebellar ataxia was defined by
the presence of progressive cerebellar ataxia without evidence of a
focal or nonfocal symptomatic origin of the disease and by the absence
of neurodegenerative disorder in relatives without evidence of
consanguinity of parents. Among patients with hereditary ataxia, 30
were carrying a CAG pathogenic expansion in one of the known ataxia
loci6 (6 patients with SCA1, 22 patients with SCA2, and 2
patients with SCA3) and 22 patients with Friedreich ataxia (FA) were
bearing a pathogenic GAA expansion in the FRDA gene.
As control subjects, we examined 161 healthy individuals aged 19 to 106
years (mean age, 74.5 ± 25.1 years).
Since previous results9 have shown pathogenic CTG expansion
in psychotic diseases not characterized by ataxia, we also
genotyped 64 patients with schizophrenia (mean ± SD age,
47.5 ± 14.6 years) and 61 patients
(mean ± SD age, 54.1 ± 15.9) with a
familial history of bipolar affective disorders. Patients and control
subjects participating in this study originated from Italy. Informed
consent was obtained for all of the genetic analyses after the nature
of the procedure had been fully explained.
GENETIC ANALYSIS
Genomic DNA was extracted from peripheral blood lymphocytes.
Polymerase chain reaction amplification was carried out with slight
modifications of the published protocol,1
with the use of the following primers: SCA8-F3:
5'-TTTGAGAAAGGCTTGTGAGGACTGAGAATG3'; and
SCA8-R4: 5'GGTCCTTCATGTTAGAAAACCTGGCT3', where F indicates forward; R,
reverse.
Amplification was done in a DNA thermal cycler (Model 9600;
Perkin-Elmer, Norwalk, Conn) with 35 cycles of amplification performed
at 94°C for 35 seconds, 64°C for 45 seconds, and 72°C for 45
seconds.
Ten microliters of each amplified DNA sample was resolved on 3%
agarose gel, stained with ethidium bromide, and visualized by UV light.
Size range of normal and expanded alleles was determined for comparison
with an appropriate DNA molecular weight standard. For an accurate
estimation of the repeat size, the polymerase chain reaction products
of all suspected cases of SCA8 were analyzed with an automated DNA
sequencer (ALF Express; Pharmacia LKB, Uppsala, Sweden). Data
were processed with fragment analysis software (Fragment Manager;
Pharmacia) with the use of a size marker (Size 50-500; Pharmacia)
according to the manufacturer's protocol.
Except for 30 patients with a known genetic defect (6 patients with
SCA1, 22 patients with SCA2, and 2 patients with SCA3), all the
subjects with ataxia were negative for CAG triplet repeat expansions
specific for the other spinocerebellar ataxia (SCA1, SCA2,
SCA3/Machado-Joseph disease, SCA6, SCA7, SCA8, and SCA12) types.
Moreover, all the 22 patients with FA examined present a GAA specific
expansion in the FRDA gene.
RESULTS
We analyzed the distribution of the SCA8 expansion in 167
patients clinically affected by ataxia and found 8 subjects
(5 patients with ataxia and 3 apparently unaffected relatives) with
abnormally expanded CTA/CTG repeats. No family history of dominant
ataxia was present in any of the patients carrying the SCA8
expansion.
In particular, pathogenic SCA8 repeat expansions were
identified in 3 patients (belonging to families DL-1 and DS-1;
Figure 1) with an apparent
autosomal recessive pure cerebellar ataxia (characterized by affected
siblings and unaffected parents), in 1 patient with ataxia who had
vitamin E deficiency (family PN-1), and in 1 patient with a sporadic
case (PR-1) with gluten ataxia. An expanded allele also has been found
in 2 unaffected parents and in 1 unaffected brother.
|
|
|
|
Figure 1.
Simplified pedigree of families with spinocerebellar ataxia type 8.
Circles indicate females; squares, males. Solid symbols represent
affected individuals, while unaffected expansion carriers are indicated
with an internal dot. For each affected individual, the number of
CTA/CTG repeats (in the normal and expanded alleles) and age at onset
are indicated. Actual age, in years, is shown in parentheses.
|
|
|
The length of the repeat tracts among individuals carrying at least 1
expanded SCA8 allele ranged between 90 and 320 combined
CTA/CTG (Figure 2).
|
|
|
|
Figure 2.
Distribution of combined CTA/CTG repeat size of the alleles at the
SCA8 locus in chromosomes belonging to subjects not carrying
expanded alleles (n = 906) (A) and in individuals
carrying expanded alleles (5 ataxic patients and 3 unaffected
relatives) (B).
|
|
|
Repeats in the normal range were observed in the remaining examined
subjects (906 total chromosomes, including 292 patients and 161
controls). In particular, all of the studied subjects not
carrying SCA8 expansion in any allele had 15 to 75 triplets
(Figure 2). The most strongly represented allele contained 25
repeats, accounting for 32.9% of all normal analyzed chromosomes. The
distribution of nonexpanded alleles (n = 906) did not
differ from the size range previously reported.1, 10
Family PN-1 (Figure 1) exhibited genetic maternal transmission (+215
repeats) from the healthy mother (presenting 105 CTA/CTG repeats, close
to the pathogenic range). The proband was 30 years old and
had had a clinical picture resembling FA without cardiac abnormalities
since the age of 7 years. Hyperreflexia and gait disturbances were
detected. She had become wheelchair bound by age 17 years. Genetic
testing showed no specific FA expansion (9 GAA triplets in both
FRDA alleles).
Recently, low serum vitamin E
concentration (0.3 µg/mL; normal range, 5.0-15.2 µg/mL) was
detected.
The patient in family PR-1 with sporadic disease developed early
symptoms at 25 years age, when he noticed tremor in his arms while
writing but not while at rest. He successively developed unsteadiness,
hyperreflexia, and dystonic postures. Pure cerebellar atrophy with
predominant involvement of the cerebellar vermis and of both
hemispheres was demonstrated by brain magnetic resonance imaging. No
electrophysiologic abnormalities were detected. Clinical diagnosis of
sporadic cerebellar ataxia was made. Since he occasionally had
diarrhea, an endoscopic biopsy of the distal duodenum was performed,
disclosing subtotal villous atrophy, crypts, hyperplasia, and moderate
increase in intraepithelial lymphocyte cell count. Positivity for IgA
antiendomysial antibodies and antitissue transglutaminase confirmed
the diagnosis of gluten ataxia. Genetic analysis showed a heterozygous
combined 159-CTA/CTG expansion at the SCA8 locus, while his
parents had both alleles in the normal range (22/24 repeats).
Genetic analysis excluded patient PR-1 from CAG triplet expansions in
the other identified SCAs and from pathogenic GAA repeats in the
frataxin gene.
Two affected brothers, belonging to family DS-1, had pure
cerebellar ataxia. Both carried an expanded allele of 90 CTG repeats.
Ages at onset was 35 and 40 years, with symptoms of gait ataxia,
unsteadiness, dysarthria, slow progression of the disease, and a brain
magnetic resonance imaging appearance of hemispheric and vermian
cerebellar atrophy. One patient showed mild pyramidal signs with
hyperreflexia and bilateral Babinski sign. The asymptomatic father had
a larger expansion of 105 CTG repeats, demonstrating a contraction of
15 repeats during paternal transmission. Brain magnetic resonance
imaging in the father showed a diffuse cortical and cerebellar atrophy.
The patients in family DS-1 had normal results for IgA and IgG
antigliadin antibodies and for vitamin E serum levels.
The asymptomatic brother in family DS-1 and the mother in family PN-1
were personally examined by us and were free of any clinical neurologic
signs.
One patient with sporadic late-onset cerebellar ataxia (family DL-1)
also showed a pathogenic expansion of 110 SCA8 repeats. His
parents were dead at the time of our study. His brother had a similar
history of tremor and probable cerebellar ataxia, but he lived in a
different country and was not examined.
COMMENT
We investigated the occurrence of the SCA8 triplet expansion
in a large Italian sample including patients with
ataxia (65 sporadic, 77 autosomal dominant
cerebellar ataxia, 3 autosomal recessive cerebellar ataxia, 22 FA),
patients with different psychiatric disorders (64 schizophrenic, 61
bipolar), and 161 control subjects. We found 8 subjects (5 patients
with ataxia and 3 apparently unaffected relatives) with abnormally
expanded CTA/CTG repeats. No pathogenic expansion has been detected in
the other subgroups of patients and in the sample of control subjects
examined (453 total subjects).
In contrast with previous reports8, 9, 10 suggesting that
SCA8 expanded CTG repeats could be a nonpathogenic
polymorphism in linkage disequilibrium with an ataxia locus, our
results support the evidence that SCA8 expansions are rare
(3% of all ataxic patients) but may confer a susceptibility
predisposing to the ataxic phenotype. These data are confirmed by the
virtual absence of pathogenic allele expansions on nonataxic patients'
chromosomes (0/572 in our study) and by the low frequency
(4.3% = 5/115) of expansions among patients with
genetically unidentified forms of hereditary (50 patients) and sporadic
(65 patients) ataxia. In addition, the absence of this expansion among
ataxic patients in whom a known genetic defect has already been
diagnosed (30 patients carrying pathogenic CAG repeats in SCA1,
SCA2, SCA3, and 22 patients with FA with GAA expansion in
the FRDA locus) could argue against the fact that CTA/CTG
triplet expansion represents a nonspecific genetic factor associated
with ataxia.
Nonpenetrant expansions found both within families with ataxia and,
rarely, in the general population have provided controversial
results.4, 8 Large trinucleotide (CTA/CTG) repeat alleles
have been observed in 1.25% of patients with various psychiatric
disorders, but none affected by, or with a family history of,
spinocerebellar ataxia.9 Interestingly, our analysis,
performed on 125 psychiatric patients, detected only 1 patient, with
bipolar disorder, carrying a normal large allele of 75
CTA/CTG repeats.
Furthermore, recent evidence3, 4 suggested that long
CTG repeats (>250 repeats) in the SCA8 gene may not
be pathogenic, possibly because they are not expressed or because
they might alter RNA processing or stability.
The presence of a 320-triplet SCA8 expansion in 1 of our
ataxic patients (in family PN-1) seems to contradict this hypothesis,
suggesting a possible role also for large expansions in the occurrence
of ataxia. Size distribution of our normal SCA8 chromosomes is
similar to the reported trimodal distribution,12 describing
classes of small (<21 CTGs), intermediate (22-33 CTGs), and large
(40-75 CTGs) alleles. The analysis of nonexpanded SCA8 allele
population provides evidence of a very low percentage (<1%) of
alleles predisposing to further expansion toward the pathogenic range
during transmission.
The limited number of patients with SCA8 carrying pathogenic expansion
has not allowed us to establish a correlation between repeat length and
clinical disease phenotype. A maternal transmission in one family
(PN-1) and a paternal contraction in family DS-1 have been detected (as
reported by others13 in a 2-generation Japanese
pedigree).
We also confirmed the marked heterogeneity of the SCA8 clinical
picture. Unusual features such as vitamin E deficiency reported in
family PN-1, or association (in family PR-1) with celiac disease (as
previously reported in a patient carrying SCA8
expansion14), suggest that the presence of other additional
unknown factors (which were absent in their respective parents) may
probably predispose to ataxia. In light of this hypothesis, CTA/CTG in
the SCA8 locus could influence but sometimes was not
sufficient to develop the ataxic phenotype.
A possible epistatic effect of the SCA8 gene on susceptibility
to malabsorption disturbances leading to ataxia could also be
conjectured. Computer-based homologic comparison with other genes
linked to malabsorption gave no evidence of any positive result until
now.
Additional investigations will be required to precisely determine the
function and the molecular mechanisms through which these expansions
could be involved in the pathogenesis of this rare disease.
AUTHOR INFORMATION
Accepted for publication July 20, 2001.
This study was supported by grant C.27 from Telethon Italia
Fondazione Organizzazione Non Lucrativa di Utilità Sociale, Rome,
and by Ministero dell'Università e della Ricerca Scientifica e
Tecnologica, Rome (protocol MM05221899-005).
From the Department of Neurological and
Psychiatric Sciences (Drs Cellini, Nacmias, Forleo, Piacentini, and
Sorbi) and Gastroenterology and Surgery Units, Department of Clinical
Pathophysiology (Drs Calabrò and Renzi), University of
Florence, Florence, Italy; and Casa di cura "Villa Serena,"
Associazione L Petruzzi, Città Sant Angelo, Pescara, Italy (Drs
Guarnieri and Serio).
Corresponding author and reprints: Sandro Sorbi, MD, Viale Morgagni,
85, 50134 Florence, Italy (e-mail: sorbi{at}unifi.it).
REFERENCES
 |  |
1. Koob MD, Moseley ML, Schut LJ, et al. An untranslated CTG expansion
causes a novel form of spinocerebellar ataxia. Nat Genet. 1999;21:379-384.
FULL TEXT
|
ISI
| PUBMED
2. Nemes JP, Benzow KA, Koob MD, et al. The SCA8 transcript is an
antisense RNA to a brain-specific transcript encoding a novel
actin-binding protein (KLHL1). Hum Mol Genet. 2000;9:1543-1551.
FREE FULL TEXT
3. Day JW, Schut LJ, Moseley ML, Durand AC, Ranum LP. Spinocerebellar
ataxia type 8: clinical features in a large family. Neurology. 2000;55:649-657.
FREE FULL TEXT
4. Moseley ML, Schut LJ, Bird TD, Koob MD, Day JW, Ranum LP. SCA8 CTG
repeat: en masse contractions in sperm and intergenerational sequence
changes may play a role in reduced penetrance. Hum Mol Genet. 2000;9:2125-2130.
FREE FULL TEXT
5. Klockgether T, Wullner U, Spauschus A, Evert B. The molecular biology
of the autosomal-dominant cerebellar ataxias. Mov Disord. 2000;15:604-612.
FULL TEXT
|
ISI
| PUBMED
6. Stevanin G, Durr A, Brice A. Clinical and molecular advances in
autosomal dominant cerebellar ataxias: from genotype to phenotype and
physiopathology. Eur J Hum Genet. 2000;8:4-18.
FULL TEXT
|
ISI
| PUBMED
7. Ikeda Y, Shizuka M, Watanabe M, Okamoto K, Shoji M. Molecular and clinical analyses of spinocerebellar ataxia type 8 in
Japan. Neurology. 2000;54:950-955.
FREE FULL TEXT
8. Stevanin G, Herman A, Durr A, et al. Are (CTG)n expansions
at the SCA8 locus rare polymorphisms? Nat Genet. 2000;24:213.
FULL TEXT
|
ISI
| PUBMED
9. Vincent JB, Neves-Pereira ML, Paterson AD, et al. An unstable
trinucleotide-repeat region on chromosome 13 implicated in
spinocerebellar ataxia: a common expansion locus. Am J Hum
Genet. 2000;66:819-829.
FULL TEXT
|
ISI
| PUBMED
10. Worth PF, Houlden H, Giunti P, Davis MB, Wood NW. Large, expanded
repeats in SCA8 are not confined to patients with cerebellar ataxia. Nat Genet. 2000;24:214-215.
FULL TEXT
|
ISI
| PUBMED
11. Harding AE. Clinical features and classification of inherited ataxias. Adv Neurol. 1993;61:1-14.
PUBMED
12. Silveira I, Alonso I, Guimaraes L, et al. High germinal instability of
the (CTG)n at the SCA8 locus of both expanded and normal
alleles. Am J Hum Genet. 2000;66:830-840.
FULL TEXT
|
ISI
| PUBMED
13. Ikeda Y, Shizuka-Ikeda M, Watanabe M, Schmitt M, Okamoto K, Shoji M. Asymptomatic CTG expansion at the SCA8 locus is associated with
cerebellar atrophy on MRI. J Neurol Sci. 2000;182:76-79.
FULL TEXT
|
ISI
| PUBMED
14. Juvonen V, Hietala M, Paivarinta M, et al. Clinical and genetic
findings in Finnish ataxia patients with the spinocerebellar ataxia 8
repeat expansion. Ann Neurol. 2000;48:354-361.
FULL TEXT
|
ISI
| PUBMED
CiteULike Connotea Del.icio.us Digg Reddit Technorati Twitter
What's this?
THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES
Trinucleotide repeats and neurodegenerative disease
Everett and Wood
Brain 2004;127:2385-2405.
ABSTRACT
| FULL TEXT
Spinocerebellar ataxia type 8 in Scotland: genetic and clinical features in seven unrelated cases and a review of published reports
Zeman et al.
J. Neurol. Neurosurg. Psychiatry 2004;75:459-465.
ABSTRACT
| FULL TEXT
A Family With Spinocerebellar Ataxia Type 8 Expansion and Vitamin E Deficiency Ataxia
Cellini et al.
Arch Neurol 2002;59:1952-1953.
ABSTRACT
| FULL TEXT
|